chr17-2680131-TTTACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAG-T

Variant names:

• chr17-2680131-TTTACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAG-T
• rs1555527743
• NM_000430.4:c.1003-30_1032delACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAGTT

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_Strong PP5_Moderate

The ENST00000397195.10(PAFAH1B1):​c.1003-30_1032delACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAGTT​(p.Val335_Leu345del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: PAFAH1B1 ENST00000397195.10 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.90
• Publications: 1 publications found

Genes affected

PAFAH1B1 (HGNC:8574): (platelet activating factor acetylhydrolase 1b regulatory subunit 1) This locus was identified as encoding a gene that when mutated or lost caused the lissencephaly associated with Miller-Dieker lissencephaly syndrome. This gene encodes the non-catalytic alpha subunit of the intracellular Ib isoform of platelet-activating factor acteylhydrolase, a heterotrimeric enzyme that specifically catalyzes the removal of the acetyl group at the SN-2 position of platelet-activating factor (identified as 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine). Two other isoforms of intracellular platelet-activating factor acetylhydrolase exist: one composed of multiple subunits, the other, a single subunit. In addition, a single-subunit isoform of this enzyme is found in serum. [provided by RefSeq, Apr 2009]

PAFAH1B1 Gene-Disease associations (from GenCC):

• lissencephaly due to LIS1 mutation

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates 0.18653690186536898 fraction of the gene. No cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 17-2680131-TTTACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAG-T is Pathogenic according to our data. Variant chr17-2680131-TTTACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAG-T is described in ClinVar as Pathogenic. ClinVar VariationId is 211817.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000397195.10. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PAFAH1B1	NM_000430.4	MANE Select	c.1003-30_1032delACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAGTT	p.Val335_Leu345del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 10 of 11	NP_000421.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PAFAH1B1	ENST00000397195.10	TSL:1 MANE Select	c.1003-30_1032delACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAGTT	p.Val335_Leu345del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 10 of 11	ENSP00000380378.4
	PAFAH1B1	ENST00000572915.6	TSL:1	n.677-3454_677-3395delACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAGTT		intron	N/A
	PAFAH1B1	ENST00000610190.2	TSL:2	n.525_584delACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAGTT		non_coding_transcript_exon	Exon 1 of 2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Lissencephaly due to LIS1 mutation (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.9
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555527743; hg19: chr17-2583425;