rs1555527743

Positions:

• chr17-2680131-TTTACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAG-T

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_000430.4(PAFAH1B1):​c.1003-30_1032delACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAGTT​(p.Val335_Leu345del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: PAFAH1B1 NM_000430.4 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.90

Genes affected

PAFAH1B1 (HGNC:8574): (platelet activating factor acetylhydrolase 1b regulatory subunit 1) This locus was identified as encoding a gene that when mutated or lost caused the lissencephaly associated with Miller-Dieker lissencephaly syndrome. This gene encodes the non-catalytic alpha subunit of the intracellular Ib isoform of platelet-activating factor acteylhydrolase, a heterotrimeric enzyme that specifically catalyzes the removal of the acetyl group at the SN-2 position of platelet-activating factor (identified as 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine). Two other isoforms of intracellular platelet-activating factor acetylhydrolase exist: one composed of multiple subunits, the other, a single subunit. In addition, a single-subunit isoform of this enzyme is found in serum. [provided by RefSeq, Apr 2009]

PAFAH1B1 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates 0.18653690186536898 fraction of the gene. No cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-2680131-TTTACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAG-T is Pathogenic according to our data. Variant chr17-2680131-TTTACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAG-T is described in ClinVar as [Pathogenic]. Clinvar id is 211817.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PAFAH1B1	NM_000430.4	c.1003-30_1032delACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAGTT	p.Val335_Leu345del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	10/11	ENST00000397195.10	NP_000421.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PAFAH1B1	ENST00000397195.10	c.1003-30_1032delACTGAGTCAAATAACTTTTTTGTTTTTAAGGTGGGTCATGATAACTGGGTACGTGGAGTT	p.Val335_Leu345del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	10/11	1	NM_000430.4	ENSP00000380378.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Lissencephaly due to LIS1 mutation Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Genetic Services Laboratory, University of Chicago

Feb 08, 2013

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555527743; hg19: chr17-2583425;