chr17-35119086-TGGAATGTGGAGATCAGGAGCTCACCTTGTAAGACAAGC-T
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_002878.4(RAD51D):c.131_144+24delGCTTGTCTTACAAGGTGAGCTCCTGATCTCCACATTCC(p.Leu45fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000344 in 1,451,634 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G44G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_002878.4 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- breast-ovarian cancer, familial, susceptibility to, 4Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- hereditary breast ovarian cancer syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary breast carcinomaInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| RAD51D | ENST00000345365.11 | c.131_144+24delGCTTGTCTTACAAGGTGAGCTCCTGATCTCCACATTCC | p.Leu45fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 2 of 10 | 1 | NM_002878.4 | ENSP00000338790.6 | ||
| ENSG00000267618 | ENST00000593039.5 | c.3+2167_3+2204delGCTTGTCTTACAAGGTGAGCTCCTGATCTCCACATTCC | intron_variant | Intron 1 of 6 | 2 | ENSP00000466834.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD2 exomes AF: 0.00000398 AC: 1AN: 251390 AF XY: 0.00000736 show subpopulations
GnomAD4 exome AF: 0.00000344 AC: 5AN: 1451634Hom.: 0 AF XY: 0.00000415 AC XY: 3AN XY: 722844 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Breast-ovarian cancer, familial, susceptibility to, 4 Pathogenic:3
This variant results in the deletion of part of exon 2 (c.131_144+24del) of the RAD51D gene. RNA analysis indicates that this variant induces altered splicing and may result in an absent or altered protein product. This variant is present in population databases (no rsID available, gnomAD no frequency). This variant has been observed in individual(s) with ovarian cancer (PMID: 22986143). ClinVar contains an entry for this variant (Variation ID: 422338). Studies have shown that this variant results in skipping of exon 2, and produces a non-functional protein and/or introduces a premature termination codon (PMID: 22986143; Invitae). For these reasons, this variant has been classified as Pathogenic. -
- -
This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -
Hereditary cancer-predisposing syndrome Pathogenic:2
The c.131_144+24del38 intronic variant, located between coding exon 2 and intron 2 of the RAD51D gene, results from a deletion of the last 14 nucleotides of coding exon 2 and the first 24 nucleotides within intron 2 of the RAD51D gene. This alteration has been reported in a proband with ovarian cancer (Wickramanayake A et al. Gynecol. Oncol. 2012 Dec;127(3):552-5). In silico splice site analysis predicts that this alteration will weaken the native splice donor site. RNA studies have demonstrated that this alteration results in abnormal splicing in the set of samples tested (Ambry internal data). Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. -
This variant is a deletion of 38 nucleotides spanning the exon2/intron 2 boundary, removing the canonical splice donor site. This variant was reported in an individual affected with ovarian cancer (PMID: 22986143). Non-quantitative RNA study in this proband has shown that this variant causes skipping of exon 2, leading to a premature translation termination (PMID: 22986143). This variant is predicted to result in an absent or non-functional protein product. This variant has been observed in 1/251390 chromosomes in the general population by the Genome Aggregation Database (gnomAD). The Loss of RAD51D gene function is a known mechanism of disease (clinicalgenome.org). Based on the available information, this variant is classified as Likely Pathogenic. -
not provided Pathogenic:1
Canonical splice site variant predicted to result in a null allele in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 25445424, 32359370, 26720728, 22986143) -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at