rs1064795716

Variant names:

• chr17-35119086-TGGAATGTGGAGATCAGGAGCTCACCTTGTAAGACAAGC-T
• rs1064795716
• NM_002878.4:c.131_144+24delGCTTGTCTTACAAGGTGAGCTCCTGATCTCCACATTCC

Variant summary

Our verdict is Pathogenic. The variant received 20 ACMG points: 20P and 0B. PVS1 PS3 PP5_Very_Strong

The NM_002878.4(RAD51D):​c.131_144+24delGCTTGTCTTACAAGGTGAGCTCCTGATCTCCACATTCC​(p.Leu45fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000344 in 1,451,634 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. Variant has been reported in ClinVar as Likely pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV000651714: Studies have shown that this variant results in skipping of exon 2, and produces a non-functional protein and/or introduces a premature termination codon (PMID:22986143" and additional evidence is available in ClinVar. Synonymous variant affecting the same amino acid position (i.e. G44G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000034 (0 hom.)
• Consequence: RAD51D NM_002878.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:6
• Conservation: PhyloP100: 2.04
• Publications: 2 publications found

Genes affected

RAD51D (HGNC:9823): (RAD51 paralog D) The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, which are known to be involved in the homologous recombination and repair of DNA. This protein forms a complex with several other members of the RAD51 family, including RAD51L1, RAD51L2, and XRCC2. The protein complex formed with this protein has been shown to catalyze homologous pairing between single- and double-stranded DNA, and is thought to play a role in the early stage of recombinational repair of DNA. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream ring finger and FYVE-like domain containing 1 (RFFL) gene. [provided by RefSeq, Jan 2011]

RAD51D Gene-Disease associations (from GenCC):

• RAD51D-related cancer predisposition

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• breast-ovarian cancer, familial, susceptibility to, 4

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• hereditary breast ovarian cancer syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000267618 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 20 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PS3: PS3 evidence extracted from ClinVar submissions: SCV000651714: Studies have shown that this variant results in skipping of exon 2, and produces a non-functional protein and/or introduces a premature termination codon (PMID: 22986143; Invitae).; SCV001340509: Non-quantitative RNA study in this proband has shown that this variant causes skipping of exon 2, leading to a premature translation termination (PMID: 22986143).; SCV002693810: RNA studies have demonstrated that this alteration results in abnormal splicing in the set of samples tested (Ambry internal data).
• PP5: Variant 17-35119086-TGGAATGTGGAGATCAGGAGCTCACCTTGTAAGACAAGC-T is Pathogenic according to our data. Variant chr17-35119086-TGGAATGTGGAGATCAGGAGCTCACCTTGTAAGACAAGC-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 422338.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002878.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RAD51D	NM_002878.4	MANE Select	c.131_144+24delGCTTGTCTTACAAGGTGAGCTCCTGATCTCCACATTCC	p.Leu45fs	frameshift splice_donor splice_region intron	Exon 2 of 10	NP_002869.3
	RAD51D	NM_001142571.2		c.131_144+24delGCTTGTCTTACAAGGTGAGCTCCTGATCTCCACATTCC	p.Gly44fs	frameshift splice_donor splice_region intron	Exon 2 of 10	NP_001136043.1	O75771-8
	RAD51D	NM_133629.3		c.131_144+24delGCTTGTCTTACAAGGTGAGCTCCTGATCTCCACATTCC	p.Leu45fs	frameshift splice_donor splice_region intron	Exon 2 of 7	NP_598332.1	O75771-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RAD51D	ENST00000345365.11	TSL:1 MANE Select	c.131_144+24delGCTTGTCTTACAAGGTGAGCTCCTGATCTCCACATTCC	p.Leu45fs	frameshift splice_donor splice_region intron	Exon 2 of 10	ENSP00000338790.6	O75771-1
	RAD51D	ENST00000586186.3	TSL:1	c.131_144+24delGCTTGTCTTACAAGGTGAGCTCCTGATCTCCACATTCC	p.Leu45fs	frameshift splice_donor splice_region intron	Exon 2 of 9	ENSP00000468273.3	O75771-4
	ENSG00000267618	ENST00000593039.5	TSL:2	c.3+2167_3+2204delGCTTGTCTTACAAGGTGAGCTCCTGATCTCCACATTCC		intron	N/A	ENSP00000466834.1	K7EN88

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251390 AF XY: 0.00000736

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.000163

GnomAD4 exome AF: 0.00000344 AC: 5 AN: 1451634 Hom.: 0 AF XY: 0.00000415 AC XY: 3 AN XY: 722844

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33210

American (AMR) AF: 0.00 AC: 0 AN: 44698

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26076

East Asian (EAS) AF: 0.00 AC: 0 AN: 39646

South Asian (SAS) AF: 0.00 AC: 0 AN: 86030

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53416

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1102714

Other (OTH) AF: 0.0000832 AC: 5 AN: 60078

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000148522), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	Breast-ovarian cancer, familial, susceptibility to, 4 (3)
2	-	-	Hereditary cancer-predisposing syndrome (2)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064795716; hg19: chr17-33446105;