chr17-43048720-CATGTTGGCCAGGCTGGTCTCAAACTCCTGACAAGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGACATGAGCCACCATGCCCAGCCTCCAGCCCATCATTTCTTGATGATTTGTTGAAACACAGTATGCTGGGGCAGTCACAGAGAGGAGGGGGAGGGACATATGGGAAAAAGAGTTAGAGGGAAAAAGTCTTCCCTCAGTATATTTAATATGTGCAGTTCTCAAATCCTTACCCATCCCTTACAGATGGAGTCTTTTGGCACAGGTATGTGGGCAGAGAAGACTTCTGAGGCTACAGTAGGGGCATCCATAGGGACTGACAGGTGCCAGTCTTGCTCACAGGAGAGAATATTGTGTCCTCCCTCTCTGACAGGGCACCCAATACTTACTGTGCCAAGGGTGAATGATGAAAGCTCCTTCACCACAGAAGCACCACACAGCTGTACCATCCATTCCAGTTGATCTAAAATGGACATTTAGATGTAAAATCACTGCAGTA-C

Variant names:

• chr17-43048720-CATGTTGGCCAGGCTGGTCTCAAACTCCTGACAAGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGACATGAGCCACCATGCCCAGCCTCCAGCCCATCATTTCTTGATGATTTGTTGAAACACAGTATGCTGGGGCAGTCACAGAGAGGAGGGGGAGGGACATATGGGAAAAAGAGTTAGAGGGAAAAAGTCTTCCCTCAGTATATTTAATATGTGCAGTTCTCAAATCCTTACCCATCCCTTACAGATGGAGTCTTTTGGCACAGGTATGTGGGCAGAGAAGACTTCTGAGGCTACAGTAGGGGCATCCATAGGGACTGACAGGTGCCAGTCTTGCTCACAGGAGAGAATATTGTGTCCTCCCTCTCTGACAGGGCACCCAATACTTACTGTGCCAAGGGTGAATGATGAAAGCTCCTTCACCACAGAAGCACCACACAGCTGTACCATCCATTCCAGTTGATCTAAAATGGACATTTAGATGTAAAATCACTGCAGTA-C
• rs1555574977
• NM_007294.4:c.5333-36_5406+400del

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_007294.4(BRCA1):​c.5333-36_5406+400del variant causes a exon loss, splice acceptor, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). The gene BRCA1 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 30)
• Consequence: BRCA1 NM_007294.4 exon_loss, splice_acceptor, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic reviewed by expert panel P:6
• Conservation: PhyloP100: 0.569
• Publications: 1 publications found

Genes affected

BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]

BRCA1 Gene-Disease associations (from GenCC):

• BRCA1-related cancer predisposition

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• breast-ovarian cancer, familial, susceptibility to, 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
• Fanconi anemia, complementation group S

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen
• pancreatic cancer, susceptibility to, 4

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary breast ovarian cancer syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fanconi anemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for BRCA1 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PP5: Variant 17-43048720-CATGTTGGCCAGGCTGGTCTCAAACTCCTGACAAGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGACATGAGCCACCATGCCCAGCCTCCAGCCCATCATTTCTTGATGATTTGTTGAAACACAGTATGCTGGGGCAGTCACAGAGAGGAGGGGGAGGGACATATGGGAAAAAGAGTTAGAGGGAAAAAGTCTTCCCTCAGTATATTTAATATGTGCAGTTCTCAAATCCTTACCCATCCCTTACAGATGGAGTCTTTTGGCACAGGTATGTGGGCAGAGAAGACTTCTGAGGCTACAGTAGGGGCATCCATAGGGACTGACAGGTGCCAGTCTTGCTCACAGGAGAGAATATTGTGTCCTCCCTCTCTGACAGGGCACCCAATACTTACTGTGCCAAGGGTGAATGATGAAAGCTCCTTCACCACAGAAGCACCACACAGCTGTACCATCCATTCCAGTTGATCTAAAATGGACATTTAGATGTAAAATCACTGCAGTA-C is Pathogenic according to our data. Variant chr17-43048720-CATGTTGGCCAGGCTGGTCTCAAACTCCTGACAAGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGACATGAGCCACCATGCCCAGCCTCCAGCCCATCATTTCTTGATGATTTGTTGAAACACAGTATGCTGGGGCAGTCACAGAGAGGAGGGGGAGGGACATATGGGAAAAAGAGTTAGAGGGAAAAAGTCTTCCCTCAGTATATTTAATATGTGCAGTTCTCAAATCCTTACCCATCCCTTACAGATGGAGTCTTTTGGCACAGGTATGTGGGCAGAGAAGACTTCTGAGGCTACAGTAGGGGCATCCATAGGGACTGACAGGTGCCAGTCTTGCTCACAGGAGAGAATATTGTGTCCTCCCTCTCTGACAGGGCACCCAATACTTACTGTGCCAAGGGTGAATGATGAAAGCTCCTTCACCACAGAAGCACCACACAGCTGTACCATCCATTCCAGTTGATCTAAAATGGACATTTAGATGTAAAATCACTGCAGTA-C is described in ClinVar as Pathogenic. ClinVar VariationId is 267601.Status of the report is reviewed_by_expert_panel, 3 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007294.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BRCA1	NM_007294.4	MANE Select	c.5333-36_5406+400del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 21 of 23	NP_009225.1	P38398-1
	BRCA1	NM_001407581.1		c.5399-36_5472+400del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 22 of 24	NP_001394510.1	A0A2R8Y7V5
	BRCA1	NM_001407582.1		c.5399-36_5472+400del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 22 of 24	NP_001394511.1	A0A2R8Y7V5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BRCA1	ENST00000357654.9	TSL:1 MANE Select	c.5333-36_5406+400del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 21 of 23	ENSP00000350283.3	P38398-1
	BRCA1	ENST00000471181.7	TSL:1	c.5396-36_5469+400del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 22 of 24	ENSP00000418960.2	P38398-7
	BRCA1	ENST00000470026.6	TSL:1	c.5333-36_5406+400del		exon_loss splice_acceptor splice_donor splice_region intron	Exon 21 of 23	ENSP00000419274.2	P38398-1

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
3	-	-	Breast-ovarian cancer, familial, susceptibility to, 1 (3)
1	-	-	BRCA1-related cancer predisposition (1)
1	-	-	Hereditary cancer-predisposing syndrome (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.57

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs1555574977;

hg19: chr17-41200737;