rs1555574977

Positions:

• chr17-43048720-CATGTTGGCCAGGCTGGTCTCAAACTCCTGACAAGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGACATGAGCCACCATGCCCAGCCTCCAGCCCATCATTTCTTGATGATTTGTTGAAACACAGTATGCTGGGGCAGTCACAGAGAGGAGGGGGAGGGACATATGGGAAAAAGAGTTAGAGGGAAAAAGTCTTCCCTCAGTATATTTAATATGTGCAGTTCTCAAATCCTTACCCATCCCTTACAGATGGAGTCTTTTGGCACAGGTATGTGGGCAGAGAAGACTTCTGAGGCTACAGTAGGGGCATCCATAGGGACTGACAGGTGCCAGTCTTGCTCACAGGAGAGAATATTGTGTCCTCCCTCTCTGACAGGGCACCCAATACTTACTGTGCCAAGGGTGAATGATGAAAGCTCCTTCACCACAGAAGCACCACACAGCTGTACCATCCATTCCAGTTGATCTAAAATGGACATTTAGATGTAAAATCACTGCAGTA-C

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_007294.4(BRCA1):​c.5333-36_5406+400del variant causes a splice acceptor, splice donor, splice donor 5th base, coding sequence, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★★).

• Frequency: Genomes: not found (cov: 30)
• Consequence: BRCA1 NM_007294.4 splice_acceptor, splice_donor, splice_donor_5th_base, coding_sequence, intron
• Clinical Significance: Pathogenic reviewed by expert panel P:5
• Conservation: PhyloP100: 0.569

Genes affected

BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-43048720-CATGTTGGCCAGGCTGGTCTCAAACTCCTGACAAGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGACATGAGCCACCATGCCCAGCCTCCAGCCCATCATTTCTTGATGATTTGTTGAAACACAGTATGCTGGGGCAGTCACAGAGAGGAGGGGGAGGGACATATGGGAAAAAGAGTTAGAGGGAAAAAGTCTTCCCTCAGTATATTTAATATGTGCAGTTCTCAAATCCTTACCCATCCCTTACAGATGGAGTCTTTTGGCACAGGTATGTGGGCAGAGAAGACTTCTGAGGCTACAGTAGGGGCATCCATAGGGACTGACAGGTGCCAGTCTTGCTCACAGGAGAGAATATTGTGTCCTCCCTCTCTGACAGGGCACCCAATACTTACTGTGCCAAGGGTGAATGATGAAAGCTCCTTCACCACAGAAGCACCACACAGCTGTACCATCCATTCCAGTTGATCTAAAATGGACATTTAGATGTAAAATCACTGCAGTA-C is Pathogenic according to our data. Variant chr17-43048720-CATGTTGGCCAGGCTGGTCTCAAACTCCTGACAAGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGACATGAGCCACCATGCCCAGCCTCCAGCCCATCATTTCTTGATGATTTGTTGAAACACAGTATGCTGGGGCAGTCACAGAGAGGAGGGGGAGGGACATATGGGAAAAAGAGTTAGAGGGAAAAAGTCTTCCCTCAGTATATTTAATATGTGCAGTTCTCAAATCCTTACCCATCCCTTACAGATGGAGTCTTTTGGCACAGGTATGTGGGCAGAGAAGACTTCTGAGGCTACAGTAGGGGCATCCATAGGGACTGACAGGTGCCAGTCTTGCTCACAGGAGAGAATATTGTGTCCTCCCTCTCTGACAGGGCACCCAATACTTACTGTGCCAAGGGTGAATGATGAAAGCTCCTTCACCACAGAAGCACCACACAGCTGTACCATCCATTCCAGTTGATCTAAAATGGACATTTAGATGTAAAATCACTGCAGTA-C is described in ClinVar as [Pathogenic]. Clinvar id is 267601.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
BRCA1	NM_007294.4	c.5333-36_5406+400del		splice_acceptor_variant, splice_donor_variant, splice_donor_5th_base_variant, coding_sequence_variant, intron_variant	21/23	ENST00000357654.9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
BRCA1	ENST00000357654.9	c.5333-36_5406+400del		splice_acceptor_variant, splice_donor_variant, splice_donor_5th_base_variant, coding_sequence_variant, intron_variant	21/23	1	NM_007294.4	P4

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:5

Revision: reviewed by expert panel

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 1 Pathogenic:3

Pathogenic, criteria provided, single submitter	clinical testing	Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge	Oct 02, 2015	- -
Pathogenic, no assertion criteria provided	clinical testing	Breast Cancer Information Core (BIC) (BRCA1)	Dec 30, 1999	- -
Pathogenic, no assertion criteria provided	clinical testing	BRCAlab, Lund University	Aug 26, 2022	- -

BRCA1-related cancer predisposition Pathogenic:1

Pathogenic, reviewed by expert panel

curation

ClinGen ENIGMA BRCA1 and BRCA2 Variant Curation Expert Panel, ClinGen

Jun 11, 2024

The c.5333-36_5406+400del variant in BRCA1 is a large deletion variant. This deletion variant was not observed in gnomAD v2.1 (exomes only, non-cancer subset) or gnomAD v3.1 (non-cancer subset), but PM2_Supporting was not applied since recall is suboptimal for this type of variant (PM2_Supporting not met). This variant has been previously reported as deletion exon 22 (legacy exon numbering) in PMIDs: 9354803, 18431737, 22544547, and 24065545. Deletion of exon 21 variant is predicted to cause a premature stop codon that is predicted to escape nonsense mediated decay, however it is a truncation of a functionally important region (sequence upstream of BRCA1 p.Leu1854 is disrupted) (PVS1 met). The ENIGMA BRCA1/BRCA2 VCEP considered multiple lines of functional and clinical evidence to define exon-specific weights for PTC in BRCA1, and results indicate that strong evidence towards pathogenicity may be applied for a PTC variant within BRCA1 exon 23 (PTC occurs before p.I1855) (PM5_Strong (PTC)). In summary, this variant meets the criteria to be classified as a Pathogenic variant for BRCA1-related cancer predisposition based on the ACMG/AMP criteria applied as specified by the ENIGMA BRCA1/2 VCEP (PVS1, PM5_Strong (PTC)). -

Hereditary cancer-predisposing syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

Feb 20, 2020

The c.5333-36_5406+400del510 pathogenic mutation, results from a deletion of 510 nucleotides at positions 5333-36 to 5406+400, spans coding exon 20 of the BRCA1 gene, and causes a translational frameshift with a predicted alternate stop codon. This specific deletion was first characterized as a recurrent finding in Dutch breast cancer families (Petrij-Bosch A et al. Nat. Genet., 1997 Nov;17:341-5). The deletion co-segregated with disease in all families identified and linkage analysis supported a founder effect in the Dutch population. Additional studies have identified this 510bp deletion in other high risk breast/ovarian cancer families (Engert S et al. Hum. Mutat., 2008 Jul;29:948-58; Rudnicka H et al. Mol. Biol. Rep., 2013 Dec;40:6619-23). Of note, this deletion is also designated as exon 22 del and g.168752_169261del in published literature. In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function due to a translational frameshift leading to premature truncation, or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555574977; hg19: chr17-41200737;