chr17-4899318-AGGCGGCCCGGGGGGCCTCGGGC-A
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The ENST00000649488.2(CHRNE):c.1077_1098delGCCCGAGGCCCCCCGGGCCGCC(p.Pro360ArgfsTer18) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. P359P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
ENST00000649488.2 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000649488.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CHRNE | NM_000080.4 | MANE Select | c.1077_1098delGCCCGAGGCCCCCCGGGCCGCC | p.Pro360ArgfsTer18 | frameshift | Exon 10 of 12 | NP_000071.1 | ||
| C17orf107 | NM_001145536.2 | MANE Select | c.-444_-423delGGCGGCCCGGGGGGCCTCGGGC | upstream_gene | N/A | NP_001139008.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CHRNE | ENST00000649488.2 | MANE Select | c.1077_1098delGCCCGAGGCCCCCCGGGCCGCC | p.Pro360ArgfsTer18 | frameshift | Exon 10 of 12 | ENSP00000497829.1 | ||
| CHRNE | ENST00000649830.1 | c.144_165delGCCCGAGGCCCCCCGGGCCGCC | p.Pro49ArgfsTer18 | frameshift | Exon 10 of 11 | ENSP00000496907.1 | |||
| CHRNE | ENST00000572438.1 | TSL:5 | n.763_784delGCCCGAGGCCCCCCGGGCCGCC | non_coding_transcript_exon | Exon 5 of 7 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at