chr17-4899325-CCGGGGGGCCTCGGGCGGCGG-C

Variant names:

• chr17-4899325-CCGGGGGGCCTCGGGCGGCGG-C
• rs932032926
• NM_000080.4:c.1072_1091delCCGCCGCCCGAGGCCCCCCG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000080.4(CHRNE):​c.1072_1091delCCGCCGCCCGAGGCCCCCCG​(p.Pro358GlyfsTer32) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000064 in 1,562,788 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P358P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.0000067 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000064 (0 hom.)
• Consequence: CHRNE NM_000080.4 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 2.36
• Publications: 0 publications found

Genes affected

CHRNE (HGNC:1966): (cholinergic receptor nicotinic epsilon subunit) Acetylcholine receptors at mature mammalian neuromuscular junctions are pentameric protein complexes composed of four subunits in the ratio of two alpha subunits to one beta, one epsilon, and one delta subunit. The acetylcholine receptor changes subunit composition shortly after birth when the epsilon subunit replaces the gamma subunit seen in embryonic receptors. Mutations in the epsilon subunit are associated with congenital myasthenic syndrome. [provided by RefSeq, Sep 2009]

C17orf107 (HGNC:37238): (chromosome 17 open reading frame 107)

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 17-4899325-CCGGGGGGCCTCGGGCGGCGG-C is Pathogenic according to our data. Variant chr17-4899325-CCGGGGGGCCTCGGGCGGCGG-C is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 534252.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000080.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHRNE	NM_000080.4	MANE Select	c.1072_1091delCCGCCGCCCGAGGCCCCCCG	p.Pro358GlyfsTer32	frameshift	Exon 10 of 12	NP_000071.1	Q04844
	C17orf107	NM_001145536.2	MANE Select	c.-437_-418delCGGGGGGCCTCGGGCGGCGG		upstream_gene	N/A	NP_001139008.1	Q6ZR85

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHRNE	ENST00000649488.2	MANE Select	c.1072_1091delCCGCCGCCCGAGGCCCCCCG	p.Pro358GlyfsTer32	frameshift	Exon 10 of 12	ENSP00000497829.1	Q04844
	CHRNE	ENST00000649830.1		c.139_158delCCGCCGCCCGAGGCCCCCCG	p.Pro47GlyfsTer32	frameshift	Exon 10 of 11	ENSP00000496907.1	A0A3B3IRM1
	CHRNE	ENST00000572438.1	TSL:5	n.758_777delCCGCCGCCCGAGGCCCCCCG		non_coding_transcript_exon	Exon 5 of 7

Frequencies

GnomAD3 genomes AF: 0.00000665 AC: 1 AN: 150314 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000593 AC: 1 AN: 168526 AF XY: 0.0000106

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000141

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000637 AC: 9 AN: 1412474 Hom.: 0 AF XY: 0.00000571 AC XY: 4 AN XY: 700108

African (AFR) AF: 0.00 AC: 0 AN: 32194

American (AMR) AF: 0.00 AC: 0 AN: 38460

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25478

East Asian (EAS) AF: 0.00 AC: 0 AN: 37176

South Asian (SAS) AF: 0.00 AC: 0 AN: 82316

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 38828

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5252

European-Non Finnish (NFE) AF: 0.00000823 AC: 9 AN: 1094062

Other (OTH) AF: 0.00 AC: 0 AN: 58708

GnomAD4 genome AF: 0.00000665 AC: 1 AN: 150314 Hom.: 0 Cov.: 32 AF XY: 0.0000136 AC XY: 1 AN XY: 73414

African (AFR) AF: 0.00 AC: 0 AN: 40808

American (AMR) AF: 0.00 AC: 0 AN: 15156

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3454

East Asian (EAS) AF: 0.00 AC: 0 AN: 5042

South Asian (SAS) AF: 0.00 AC: 0 AN: 4736

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10430

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.0000148 AC: 1 AN: 67432

Other (OTH) AF: 0.00 AC: 0 AN: 2072

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000189

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Congenital myasthenic syndrome 4A (2)
1	-	-	CHRNE-related disorder (1)
1	-	-	Congenital myasthenic syndrome (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.4
Mutation Taster		=6/194	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs932032926; hg19: chr17-4802620;