chr17-50196664-TGAAACCCTAAAGCAGGAAAGAGGTAGAAGGTAAGAACCTGTG-T

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_ModeratePP5_Moderate

The NM_000088.4(COL1A1):​c.805-36_810delCACAGGTTCTTACCTTCTACCTCTTTCCTGCTTTAGGGTTTC​(p.Gly269_Ser271del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

COL1A1
NM_000088.4 splice_acceptor, conservative_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 8.10

Publications

0 publications found
Variant links:
Genes affected
COL1A1 (HGNC:2197): (collagen type I alpha 1 chain) This gene encodes the pro-alpha1 chains of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIA, Ehlers-Danlos syndrome Classical type, Caffey Disease and idiopathic osteoporosis. Reciprocal translocations between chromosomes 17 and 22, where this gene and the gene for platelet-derived growth factor beta are located, are associated with a particular type of skin tumor called dermatofibrosarcoma protuberans, resulting from unregulated expression of the growth factor. Two transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]
COL1A1 Gene-Disease associations (from GenCC):
  • Caffey disease
    Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae), G2P, ClinGen
  • combined osteogenesis imperfecta and Ehlers-Danlos syndrome 1
    Inheritance: AD Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, ClinGen
  • Ehlers-Danlos syndrome
    Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
  • Ehlers-Danlos syndrome, arthrochalasia type
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, PanelApp Australia, G2P, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen
  • osteogenesis imperfecta type 1
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
  • osteogenesis imperfecta type 2
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
  • osteogenesis imperfecta type 3
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
  • osteogenesis imperfecta type 4
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet, ClinGen
  • Ehlers-Danlos syndrome, classic type, 1
    Inheritance: AD Classification: MODERATE Submitted by: ClinGen
  • Ehlers-Danlos syndrome, classic type
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Ehlers-Danlos/osteogenesis imperfecta syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • high bone mass osteogenesis imperfecta
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.012286689 fraction of the gene. Cryptic splice site detected, with MaxEntScore 5.4, offset of 8, new splice context is: aggctgttccaccccctcAGtgg. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
PP5
Variant 17-50196664-TGAAACCCTAAAGCAGGAAAGAGGTAGAAGGTAAGAACCTGTG-T is Pathogenic according to our data. Variant chr17-50196664-TGAAACCCTAAAGCAGGAAAGAGGTAGAAGGTAAGAACCTGTG-T is described in ClinVar as [Pathogenic]. Clinvar id is 447146.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
COL1A1NM_000088.4 linkc.805-36_810delCACAGGTTCTTACCTTCTACCTCTTTCCTGCTTTAGGGTTTC p.Gly269_Ser271del splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 12 of 51 ENST00000225964.10 NP_000079.2 P02452
COL1A1XM_011524341.2 linkc.805-36_810delCACAGGTTCTTACCTTCTACCTCTTTCCTGCTTTAGGGTTTC p.Gly269_Ser271del splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 12 of 48 XP_011522643.1
COL1A1XM_005257058.5 linkc.805-36_810delCACAGGTTCTTACCTTCTACCTCTTTCCTGCTTTAGGGTTTC p.Gly269_Ser271del splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 12 of 49 XP_005257115.2
COL1A1XM_005257059.5 linkc.805-36_810delCACAGGTTCTTACCTTCTACCTCTTTCCTGCTTTAGGGTTTC p.Gly269_Ser271del splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 12 of 38 XP_005257116.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
COL1A1ENST00000225964.10 linkc.805-36_810delCACAGGTTCTTACCTTCTACCTCTTTCCTGCTTTAGGGTTTC p.Gly269_Ser271del splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 12 of 51 1 NM_000088.4 ENSP00000225964.6 P02452
COL1A1ENST00000495677.1 linkn.532-36_537delCACAGGTTCTTACCTTCTACCTCTTTCCTGCTTTAGGGTTTC splice_acceptor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant Exon 7 of 8 3
COL1A1ENST00000485870.1 linkn.-111_-70delCACAGGTTCTTACCTTCTACCTCTTTCCTGCTTTAGGGTTTC upstream_gene_variant 3

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Pathogenic:1
May 23, 2017
Athena Diagnostics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
8.1
Mutation Taster
=14/186
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555574450; hg19: chr17-48274025; API