rs1555574450
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_ModeratePP5_Moderate
The NM_000088.4(COL1A1):c.805-36_810delCACAGGTTCTTACCTTCTACCTCTTTCCTGCTTTAGGGTTTC(p.Gly269_Ser271del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_000088.4 splice_acceptor, conservative_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Caffey diseaseInheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics
- COL1A1-related Ehlers-Danlos syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- combined osteogenesis imperfecta and Ehlers-Danlos syndrome 1Inheritance: AD Classification: DEFINITIVE, MODERATE Submitted by: ClinGen, Ambry Genetics
- Ehlers-Danlos syndromeInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- Ehlers-Danlos syndrome, arthrochalasia typeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, G2P, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
- osteogenesis imperfectaInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- osteogenesis imperfecta type 1Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- osteogenesis imperfecta type 2Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- osteogenesis imperfecta type 3Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
- osteogenesis imperfecta type 4Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, G2P, Orphanet
- Ehlers-Danlos syndrome, classic type, 1Inheritance: AD Classification: MODERATE Submitted by: ClinGen
- Ehlers-Danlos syndrome, classic typeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Ehlers-Danlos/osteogenesis imperfecta syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- high bone mass osteogenesis imperfectaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000088.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL1A1 | TSL:1 MANE Select | c.805-36_810delCACAGGTTCTTACCTTCTACCTCTTTCCTGCTTTAGGGTTTC | p.Gly269_Ser271del | splice_acceptor conservative_inframe_deletion splice_region intron | Exon 12 of 51 | ENSP00000225964.6 | P02452 | ||
| COL1A1 | c.805-36_810delCACAGGTTCTTACCTTCTACCTCTTTCCTGCTTTAGGGTTTC | p.Gly269_Ser271del | splice_acceptor conservative_inframe_deletion splice_region intron | Exon 12 of 51 | ENSP00000531393.1 | ||||
| COL1A1 | c.805-36_810delCACAGGTTCTTACCTTCTACCTCTTTCCTGCTTTAGGGTTTC | p.Gly269_Ser271del | splice_acceptor conservative_inframe_deletion splice_region intron | Exon 12 of 51 | ENSP00000531398.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.