chr17-58692629-GCAGGTGAGCCTGCGATGCGCGGGAAGA-G

Variant names:

• chr17-58692629-GCAGGTGAGCCTGCGATGCGCGGGAAGA-G
• NM_058216.3:c.-13_14delAGGTGAGCCTGCGATGCGCGGGAAGAC

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PVS1_Supporting PM2 PP5_Moderate

The NM_058216.3(RAD51C):​c.-13_14delAGGTGAGCCTGCGATGCGCGGGAAGAC​(p.Met1_Thr5del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: RAD51C NM_058216.3 start_lost, conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.0350

Genes affected

RAD51C (HGNC:9820): (RAD51 paralog C) This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PVS1: Start lost variant, no pathogenic variants between lost start and next in-frame start position. Next in-frame start position is after 27 CDS bases. Genomic position: 58692670. Lost 0.024 part of the original CDS.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-58692629-GCAGGTGAGCCTGCGATGCGCGGGAAGA-G is Pathogenic according to our data. Variant chr17-58692629-GCAGGTGAGCCTGCGATGCGCGGGAAGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 1098890.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RAD51C	NM_058216.3	c.-13_14delAGGTGAGCCTGCGATGCGCGGGAAGAC	p.Met1_Thr5del	start_lost, conservative_inframe_deletion	Exon 1 of 9	ENST00000337432.9	NP_478123.1
RAD51C	NM_058216.3	c.-13_14delAGGTGAGCCTGCGATGCGCGGGAAGAC		5_prime_UTR_variant	Exon 1 of 9	ENST00000337432.9	NP_478123.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RAD51C	ENST00000337432.9	c.-13_14delAGGTGAGCCTGCGATGCGCGGGAAGAC	p.Met1_Thr5del	start_lost, conservative_inframe_deletion	Exon 1 of 9	1	NM_058216.3	ENSP00000336701.4
RAD51C	ENST00000337432	c.-13_14delAGGTGAGCCTGCGATGCGCGGGAAGAC		5_prime_UTR_variant	Exon 1 of 9	1	NM_058216.3	ENSP00000336701.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 3 Pathogenic:1

Pathogenic, criteria provided, single submitter

curation

Hereditary Cancer Group, L’Institut d'Investigació Biomèdica de Bellvitge

May 03, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-56769990;