chr17-61683290-GTATTATTACTTAAAACCAGGAAACA-G

Position:

• chr17-61683290-GTATTATTACTTAAAACCAGGAAACA-G

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_032043.3(BRIP1):​c.3731_*5del variant causes a stop lost, 3 prime UTR change. The variant allele was found at a frequency of 0.000000688 in 1,452,444 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: BRIP1 NM_032043.3 stop_lost, 3_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 3.65

Genes affected

BRIP1 (HGNC:20473): (BRCA1 interacting helicase 1) The protein encoded by this gene is a member of the RecQ DEAH helicase family and interacts with the BRCT repeats of breast cancer, type 1 (BRCA1). The bound complex is important in the normal double-strand break repair function of breast cancer, type 1 (BRCA1). This gene may be a target of germline cancer-inducing mutations. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Stoplost variant. No alternative stopcodon identified downstream, so we assume a Nonstop Mediated Decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
BRIP1	NM_032043.3	c.3731_*5del		stop_lost, 3_prime_UTR_variant	20/20	ENST00000259008.7

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
BRIP1	ENST00000259008.7	c.3731_*5del		stop_lost, 3_prime_UTR_variant	20/20	1	NM_032043.3	P2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 6.88e-7 AC: 1 AN: 1452444 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 723162

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.06e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Familial cancer of breast;C1836860:Fanconi anemia complementation group J Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Apr 19, 2023

This variant has not been reported in the literature in individuals affected with BRIP1-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Met1244Thrfs*2) in the BRIP1 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 6 amino acid(s) of the BRIP1 protein. ClinVar contains an entry for this variant (Variation ID: 461165). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. -

Hereditary cancer-predisposing syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

May 24, 2024

The c.3731_*5del25 variant (also known as p.M1244Tfs*2), located between coding exon 19 and the 3'-UTR of the BRIP1 gene, results from a deletion of 25 nucleotides (TGTTTCCTGGTTTTAAGTAATAATA) at positions 3731 to *5 causing a translational frameshift with a predicted alternate stop codon. This alteration occurs at the 3' terminus of the BRIP1 gene, is not expected to trigger nonsense-mediated mRNA decay, and only impacts the last 6 amino acids of the protein. The exact functional effect of this alteration is unknown. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555572407; hg19: chr17-59760651;