rs1555572407

Variant names:

• chr17-61683290-GTATTATTACTTAAAACCAGGAAACA-G
• rs1555572407
• NM_032043.3:c.3731_*5delTGTTTCCTGGTTTTAAGTAATAATA

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_032043.3(BRIP1):​c.3731_*5delTGTTTCCTGGTTTTAAGTAATAATA​(p.Met1244fs) variant causes a frameshift, stop lost change. The variant allele was found at a frequency of 0.000000688 in 1,452,444 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: BRIP1 NM_032043.3 frameshift, stop_lost
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 3.65
• Publications: 1 publications found

Genes affected

BRIP1 (HGNC:20473): (BRCA1 interacting helicase 1) The protein encoded by this gene is a member of the RecQ DEAH helicase family and interacts with the BRCT repeats of breast cancer, type 1 (BRCA1). The bound complex is important in the normal double-strand break repair function of breast cancer, type 1 (BRCA1). This gene may be a target of germline cancer-inducing mutations. [provided by RefSeq, Jul 2008]

BRIP1 Gene-Disease associations (from GenCC):

• familial ovarian cancer

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• Fanconi anemia

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Illumina, Orphanet
• Fanconi anemia complementation group J

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae), Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: STRONG, LIMITED, NO_KNOWN Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics, ClinGen
• colorectal adenoma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Stoplost variant. No alternative stopcodon identified downstream, so we assume a Nonstop Mediated Decay. LoF is a known mechanism of disease.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_032043.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BRIP1	NM_032043.3	MANE Select	c.3731_*5delTGTTTCCTGGTTTTAAGTAATAATA	p.Met1244fs	frameshift stop_lost	Exon 20 of 20	NP_114432.2	Q9BX63-1
	BRIP1	NM_032043.3	MANE Select	c.3731_*5delTGTTTCCTGGTTTTAAGTAATAATA		3_prime_UTR	Exon 20 of 20	NP_114432.2	Q9BX63-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BRIP1	ENST00000259008.7	TSL:1 MANE Select	c.3731_*5delTGTTTCCTGGTTTTAAGTAATAATA	p.Met1244fs	frameshift stop_lost	Exon 20 of 20	ENSP00000259008.2	Q9BX63-1
	BRIP1	ENST00000259008.7	TSL:1 MANE Select	c.3731_*5delTGTTTCCTGGTTTTAAGTAATAATA		3_prime_UTR	Exon 20 of 20	ENSP00000259008.2	Q9BX63-1
	BRIP1	ENST00000682453.1		c.3731_*5delTGTTTCCTGGTTTTAAGTAATAATA	p.Met1244fs	frameshift stop_lost	Exon 21 of 21	ENSP00000506943.1	Q9BX63-1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 6.88e-7 AC: 1 AN: 1452444 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 723162

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33254

American (AMR) AF: 0.00 AC: 0 AN: 44614

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26068

East Asian (EAS) AF: 0.00 AC: 0 AN: 39542

South Asian (SAS) AF: 0.00 AC: 0 AN: 85654

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53382

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5656

European-Non Finnish (NFE) AF: 9.06e-7 AC: 1 AN: 1104240

Other (OTH) AF: 0.00 AC: 0 AN: 60034

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Familial cancer of breast;C1836860:Fanconi anemia complementation group J (1)
-	1	-	Hereditary cancer-predisposing syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555572407; hg19: chr17-59760651;