rs1555572407

Variant names:

• chr17-61683290-GTATTATTACTTAAAACCAGGAAACA-G
• rs1555572407
• NM_032043.3:c.3731_*5delTGTTTCCTGGTTTTAAGTAATAATA

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_032043.3(BRIP1):​c.3731_*5delTGTTTCCTGGTTTTAAGTAATAATA​(p.Met1244fs) variant causes a frameshift, stop lost change. The variant allele was found at a frequency of 0.000000688 in 1,452,444 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: BRIP1 NM_032043.3 frameshift, stop_lost
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 3.65

Genes affected

BRIP1 (HGNC:20473): (BRCA1 interacting helicase 1) The protein encoded by this gene is a member of the RecQ DEAH helicase family and interacts with the BRCT repeats of breast cancer, type 1 (BRCA1). The bound complex is important in the normal double-strand break repair function of breast cancer, type 1 (BRCA1). This gene may be a target of germline cancer-inducing mutations. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Stoplost variant. No alternative stopcodon identified downstream, so we assume a Nonstop Mediated Decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BRIP1	NM_032043.3	c.3731_*5delTGTTTCCTGGTTTTAAGTAATAATA	p.Met1244fs	frameshift_variant, stop_lost	Exon 20 of 20	ENST00000259008.7	NP_114432.2
BRIP1	NM_032043.3	c.3730_*5delTGTTTCCTGGTTTTAAGTAATAATA		3_prime_UTR_variant	Exon 20 of 20	ENST00000259008.7	NP_114432.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BRIP1	ENST00000259008.7	c.3731_*5delTGTTTCCTGGTTTTAAGTAATAATA	p.Met1244fs	frameshift_variant, stop_lost	Exon 20 of 20	1	NM_032043.3	ENSP00000259008.2
BRIP1	ENST00000259008	c.3730_*5delTGTTTCCTGGTTTTAAGTAATAATA		3_prime_UTR_variant	Exon 20 of 20	1	NM_032043.3	ENSP00000259008.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 6.88e-7 AC: 1 AN: 1452444 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 723162

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.06e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Familial cancer of breast;C1836860:Fanconi anemia complementation group J Uncertain:1

Jul 23, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Met1244Thrfs*2) in the BRIP1 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 6 amino acid(s) of the BRIP1 protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with BRIP1-related conditions. ClinVar contains an entry for this variant (Variation ID: 461165). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Hereditary cancer-predisposing syndrome Uncertain:1

May 24, 2024

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.3731_*5del25 variant (also known as p.M1244Tfs*2), located between coding exon 19 and the 3'-UTR of the BRIP1 gene, results from a deletion of 25 nucleotides (TGTTTCCTGGTTTTAAGTAATAATA) at positions 3731 to *5 causing a translational frameshift with a predicted alternate stop codon. This alteration occurs at the 3' terminus of the BRIP1 gene, is not expected to trigger nonsense-mediated mRNA decay, and only impacts the last 6 amino acids of the protein. The exact functional effect of this alteration is unknown. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555572407; hg19: chr17-59760651;