chr17-65538219-A-AGGCGCTCCTCCAGGCTGTGGC

Variant names:

• chr17-65538219-A-AGGCGCTCCTCCAGGCTGTGGC
• rs1555578452
• NM_004655.4:c.1163_1183dupGCCACAGCCTGGAGGAGCGCC

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_004655.4(AXIN2):​c.1163_1183dupGCCACAGCCTGGAGGAGCGCC​(p.Arg388_Arg394dup) variant causes a conservative inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. L395L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 34)
• Consequence: AXIN2 NM_004655.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 8.62
• Publications: 0 publications found

Genes affected

AXIN2 (HGNC:904): (axin 2) The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]

AXIN2 Gene-Disease associations (from GenCC):

• oligodontia-cancer predisposition syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)
• tooth agenesis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• craniosynostosis

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ENSG00000266076 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_004655.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004655.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AXIN2	NM_004655.4	MANE Select	c.1163_1183dupGCCACAGCCTGGAGGAGCGCC	p.Arg388_Arg394dup	conservative_inframe_insertion	Exon 5 of 11	NP_004646.3	Q9Y2T1
	AXIN2	NM_001363813.1		c.1163_1183dupGCCACAGCCTGGAGGAGCGCC	p.Arg388_Arg394dup	conservative_inframe_insertion	Exon 5 of 10	NP_001350742.1	E7ES00

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AXIN2	ENST00000307078.10	TSL:1 MANE Select	c.1163_1183dupGCCACAGCCTGGAGGAGCGCC	p.Arg388_Arg394dup	conservative_inframe_insertion	Exon 5 of 11	ENSP00000302625.5	Q9Y2T1
	AXIN2	ENST00000375702.5	TSL:1	c.1163_1183dupGCCACAGCCTGGAGGAGCGCC	p.Arg388_Arg394dup	conservative_inframe_insertion	Exon 4 of 9	ENSP00000364854.5	E7ES00
	ENSG00000266076	ENST00000577662.1	TSL:2	n.*1339_*1359dupGCCACAGCCTGGAGGAGCGCC		non_coding_transcript_exon	Exon 7 of 7	ENSP00000462418.1	J3KSC3

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD4 exome Cov.: 38

GnomAD4 genome Cov.: 34

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Hereditary cancer-predisposing syndrome (1)
-	1	-	Oligodontia-cancer predisposition syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555578452; hg19: chr17-63534337;