rs1555578452

Variant names:

• chr17-65538219-A-AGGCGCTCCTCCAGGCTGTGGC
• rs1555578452
• NM_004655.4:c.1163_1183dupGCCACAGCCTGGAGGAGCGCC

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_004655.4(AXIN2):​c.1163_1183dupGCCACAGCCTGGAGGAGCGCC​(p.Arg388_Arg394dup) variant causes a conservative inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 34)
• Consequence: AXIN2 NM_004655.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 8.62

Genes affected

AXIN2 (HGNC:904): (axin 2) The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]

ENSG00000266076 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_004655.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AXIN2	NM_004655.4	c.1163_1183dupGCCACAGCCTGGAGGAGCGCC	p.Arg388_Arg394dup	conservative_inframe_insertion	Exon 5 of 11	ENST00000307078.10	NP_004646.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AXIN2	ENST00000307078.10	c.1163_1183dupGCCACAGCCTGGAGGAGCGCC	p.Arg388_Arg394dup	conservative_inframe_insertion	Exon 5 of 11	1	NM_004655.4	ENSP00000302625.5
ENSG00000266076	ENST00000577662.1	n.*1339_*1359dupGCCACAGCCTGGAGGAGCGCC		non_coding_transcript_exon_variant	Exon 7 of 7	2		ENSP00000462418.1
ENSG00000266076	ENST00000577662.1	n.*1339_*1359dupGCCACAGCCTGGAGGAGCGCC		3_prime_UTR_variant	Exon 7 of 7	2		ENSP00000462418.1

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD4 exome Cov.: 38

GnomAD4 genome Cov.: 34

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Oligodontia-cancer predisposition syndrome Uncertain:1

Dec 19, 2016

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, this variant is a novel in-frame duplication of 7 amino acid residues with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a AXIN2-related disease. This sequence change inserts 21 nucleotides in exon 5 of the AXIN2 mRNA (c.1163_1183dup21). This leads to the insertion of 7 amino acid residues in the AXIN2 protein (p.Arg388_Arg394dup) but otherwise preserves the integrity of the reading frame. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the duplicated amino acids is currently unknown. -

Hereditary cancer-predisposing syndrome Uncertain:1

Jul 12, 2024

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1163_1183dup21 variant (also known as p.R388_R394dup), located in coding exon 4 of the AXIN2 gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 1163 to 1183. This results in the duplication of 7 extra residues (RHSLEER) between codons 388 and 394. This amino acid region is well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555578452; hg19: chr17-63534337;