rs1555578452
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP3
The NM_004655.4(AXIN2):c.1163_1183dupGCCACAGCCTGGAGGAGCGCC(p.Arg388_Arg394dup) variant causes a conservative inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. L395L) has been classified as Likely benign.
Frequency
Consequence
NM_004655.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- oligodontia-cancer predisposition syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)
- tooth agenesisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- craniosynostosisInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004655.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AXIN2 | MANE Select | c.1163_1183dupGCCACAGCCTGGAGGAGCGCC | p.Arg388_Arg394dup | conservative_inframe_insertion | Exon 5 of 11 | NP_004646.3 | Q9Y2T1 | ||
| AXIN2 | c.1163_1183dupGCCACAGCCTGGAGGAGCGCC | p.Arg388_Arg394dup | conservative_inframe_insertion | Exon 5 of 10 | NP_001350742.1 | E7ES00 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AXIN2 | TSL:1 MANE Select | c.1163_1183dupGCCACAGCCTGGAGGAGCGCC | p.Arg388_Arg394dup | conservative_inframe_insertion | Exon 5 of 11 | ENSP00000302625.5 | Q9Y2T1 | ||
| AXIN2 | TSL:1 | c.1163_1183dupGCCACAGCCTGGAGGAGCGCC | p.Arg388_Arg394dup | conservative_inframe_insertion | Exon 4 of 9 | ENSP00000364854.5 | E7ES00 | ||
| ENSG00000266076 | TSL:2 | n.*1339_*1359dupGCCACAGCCTGGAGGAGCGCC | non_coding_transcript_exon | Exon 7 of 7 | ENSP00000462418.1 | J3KSC3 |
Frequencies
GnomAD3 genomes Cov.: 34
GnomAD4 exome Cov.: 38
GnomAD4 genome Cov.: 34
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at