chr17-7222246-CGTGAAGGAGAAGATCACAGCTTTT-C

Position:

• chr17-7222246-CGTGAAGGAGAAGATCACAGCTTTT-C

Variant summary

Our verdict is Likely pathogenic. Variant got 9 ACMG points: 9P and 0B. PM1 PM2 PM4 PP3 PP5_Moderate

The ENST00000356839.10(ACADVL):​c.826_849delAAGGAGAAGATCACAGCTTTTGTG​(p.Lys276_Val283del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,461,856 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. K276K) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: ACADVL ENST00000356839.10 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.38

Genes affected

ACADVL (HGNC:92): (acyl-CoA dehydrogenase very long chain) The protein encoded by this gene is targeted to the inner mitochondrial membrane where it catalyzes the first step of the mitochondrial fatty acid beta-oxidation pathway. This acyl-Coenzyme A dehydrogenase is specific to long-chain and very-long-chain fatty acids. A deficiency in this gene product reduces myocardial fatty acid beta-oxidation and is associated with cardiomyopathy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

ACADVL (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 9 ACMG points.

• PM1: In a hotspot region, there are 4 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 10 uncertain in ENST00000356839.10
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in ENST00000356839.10.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 17-7222246-CGTGAAGGAGAAGATCACAGCTTTT-C is Pathogenic according to our data. Variant chr17-7222246-CGTGAAGGAGAAGATCACAGCTTTT-C is described in ClinVar as [Pathogenic]. Clinvar id is 541719.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ACADVL	NM_000018.4	c.826_849delAAGGAGAAGATCACAGCTTTTGTG	p.Lys276_Val283del	conservative_inframe_deletion	9/20	ENST00000356839.10	NP_000009.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ACADVL	ENST00000356839.10	c.826_849delAAGGAGAAGATCACAGCTTTTGTG	p.Lys276_Val283del	conservative_inframe_deletion	9/20	1	NM_000018.4	ENSP00000349297.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1461856 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727232

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000270

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Very long chain acyl-CoA dehydrogenase deficiency Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

May 22, 2023

ClinVar contains an entry for this variant (Variation ID: 541719). This variant has not been reported in the literature in individuals affected with ACADVL-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.826_849del, results in the deletion of 8 amino acid(s) of the ACADVL protein (p.Lys276_Val283del), but otherwise preserves the integrity of the reading frame. For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the ACADVL protein in which other variant(s) (p.Glu277del) have been determined to be pathogenic (PMID: 23169530, 23430948, 27209629, 30194637). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555528367; hg19: chr17-7125565;