rs1555528367

Variant names:

• chr17-7222246-CGTGAAGGAGAAGATCACAGCTTTT-C
• rs1555528367
• NM_000018.4:c.826_849delAAGGAGAAGATCACAGCTTTTGTG

Variant summary

Our verdict is Likely pathogenic. The variant received 7 ACMG points: 7P and 0B. PM1 PM4 PP3 PP5_Moderate

The NM_000018.4(ACADVL):​c.826_849delAAGGAGAAGATCACAGCTTTTGTG​(p.Lys276_Val283del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,461,856 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. K276K) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: ACADVL NM_000018.4 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.38
• Publications: 0 publications found

Genes affected

ACADVL (HGNC:92): (acyl-CoA dehydrogenase very long chain) The protein encoded by this gene is targeted to the inner mitochondrial membrane where it catalyzes the first step of the mitochondrial fatty acid beta-oxidation pathway. This acyl-Coenzyme A dehydrogenase is specific to long-chain and very-long-chain fatty acids. A deficiency in this gene product reduces myocardial fatty acid beta-oxidation and is associated with cardiomyopathy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

ACADVL Gene-Disease associations (from GenCC):

• very long chain acyl-CoA dehydrogenase deficiency

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, ClinGen, PanelApp Australia, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 7 ACMG points.

• PM1: In a hotspot region, there are 4 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 12 uncertain in NM_000018.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000018.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 17-7222246-CGTGAAGGAGAAGATCACAGCTTTT-C is Pathogenic according to our data. Variant chr17-7222246-CGTGAAGGAGAAGATCACAGCTTTT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 541719.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ACADVL	NM_000018.4	c.826_849delAAGGAGAAGATCACAGCTTTTGTG	p.Lys276_Val283del	conservative_inframe_deletion	Exon 9 of 20	ENST00000356839.10	NP_000009.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ACADVL	ENST00000356839.10	c.826_849delAAGGAGAAGATCACAGCTTTTGTG	p.Lys276_Val283del	conservative_inframe_deletion	Exon 9 of 20	1	NM_000018.4	ENSP00000349297.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1461856 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727232

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53394

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000270 AC: 3 AN: 1112004

Other (OTH) AF: 0.00 AC: 0 AN: 60392

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Very long chain acyl-CoA dehydrogenase deficiency Pathogenic:1

May 22, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the ACADVL protein in which other variant(s) (p.Glu277del) have been determined to be pathogenic (PMID: 23169530, 23430948, 27209629, 30194637). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. ClinVar contains an entry for this variant (Variation ID: 541719). This variant has not been reported in the literature in individuals affected with ACADVL-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.826_849del, results in the deletion of 8 amino acid(s) of the ACADVL protein (p.Lys276_Val283del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555528367; hg19: chr17-7125565;