rs1555528367

Variant names:

• chr17-7222246-CGTGAAGGAGAAGATCACAGCTTTT-C
• rs1555528367
• NM_000018.4:c.826_849delAAGGAGAAGATCACAGCTTTTGTG

Variant summary

Our verdict is Likely pathogenic. The variant received 7 ACMG points: 7P and 0B. PM1 PM4 PP3 PP5_Moderate

The NM_000018.4(ACADVL):​c.826_849delAAGGAGAAGATCACAGCTTTTGTG​(p.Lys276_Val283del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,461,856 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. K276K) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: ACADVL NM_000018.4 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.38
• Publications: 0 publications found

Genes affected

ACADVL (HGNC:92): (acyl-CoA dehydrogenase very long chain) The protein encoded by this gene is targeted to the inner mitochondrial membrane where it catalyzes the first step of the mitochondrial fatty acid beta-oxidation pathway. This acyl-Coenzyme A dehydrogenase is specific to long-chain and very-long-chain fatty acids. A deficiency in this gene product reduces myocardial fatty acid beta-oxidation and is associated with cardiomyopathy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

ACADVL Gene-Disease associations (from GenCC):

• very long chain acyl-CoA dehydrogenase deficiency

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, G2P, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 7 ACMG points.

• PM1: In a hotspot region, there are 4 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 12 uncertain in NM_000018.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000018.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 17-7222246-CGTGAAGGAGAAGATCACAGCTTTT-C is Pathogenic according to our data. Variant chr17-7222246-CGTGAAGGAGAAGATCACAGCTTTT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 541719.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000018.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ACADVL	NM_000018.4	MANE Select	c.826_849delAAGGAGAAGATCACAGCTTTTGTG	p.Lys276_Val283del	conservative_inframe_deletion	Exon 9 of 20	NP_000009.1	P49748-1
	ACADVL	NM_001270447.2		c.895_918delAAGGAGAAGATCACAGCTTTTGTG	p.Lys299_Val306del	conservative_inframe_deletion	Exon 10 of 21	NP_001257376.1	P49748-3
	ACADVL	NM_001033859.3		c.760_783delAAGGAGAAGATCACAGCTTTTGTG	p.Lys254_Val261del	conservative_inframe_deletion	Exon 8 of 19	NP_001029031.1	P49748-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ACADVL	ENST00000356839.10	TSL:1 MANE Select	c.826_849delAAGGAGAAGATCACAGCTTTTGTG	p.Lys276_Val283del	conservative_inframe_deletion	Exon 9 of 20	ENSP00000349297.5	P49748-1
	ACADVL	ENST00000350303.9	TSL:1	c.760_783delAAGGAGAAGATCACAGCTTTTGTG	p.Lys254_Val261del	conservative_inframe_deletion	Exon 8 of 19	ENSP00000344152.5	P49748-2
	ACADVL	ENST00000543245.6	TSL:2	c.895_918delAAGGAGAAGATCACAGCTTTTGTG	p.Lys299_Val306del	conservative_inframe_deletion	Exon 10 of 21	ENSP00000438689.2	P49748-3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1461856 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727232

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53394

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000270 AC: 3 AN: 1112004

Other (OTH) AF: 0.00 AC: 0 AN: 60392

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Very long chain acyl-CoA dehydrogenase deficiency (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555528367; hg19: chr17-7125565;