chr17-7403142-CCACTCAGAGCCTGGTAGTAAAA-C

Variant names:

• chr17-7403142-CCACTCAGAGCCTGGTAGTAAAA-C
• rs886039795
• NM_152766.5:c.244_265delTTTTACTACCAGGCTCTGAGTG

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The NM_152766.5(TMEM256):​c.244_265delTTTTACTACCAGGCTCTGAGTG​(p.Phe82GlufsTer31) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TMEM256 NM_152766.5 frameshift
• Clinical Significance: Likely pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 5.02
• Publications: 0 publications found

Genes affected

TMEM256 (HGNC:28618): (transmembrane protein 256) Located in extracellular exosome. [provided by Alliance of Genome Resources, Apr 2022]

TMEM256-PLSCR3 (HGNC:49186): (TMEM256-PLSCR3 readthrough (NMD candidate)) This locus represents naturally occurring read-through transcription between the neighboring chromosome 17 open reading frame 61 (C17orf61) and phospholipid scramblase 3 (PLSCR3) genes. The read-through transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Jan 2011]

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant 17-7403142-CCACTCAGAGCCTGGTAGTAAAA-C is Pathogenic according to our data. Variant chr17-7403142-CCACTCAGAGCCTGGTAGTAAAA-C is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 266078.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_152766.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM256	NM_152766.5	MANE Select	c.244_265delTTTTACTACCAGGCTCTGAGTG	p.Phe82GlufsTer31	frameshift	Exon 4 of 4	NP_689979.1	Q8N2U0
	TMEM256-PLSCR3	NR_037719.1		n.164+494_164+515delTTTTACTACCAGGCTCTGAGTG		intron	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM256	ENST00000302422.4	TSL:1 MANE Select	c.244_265delTTTTACTACCAGGCTCTGAGTG	p.Phe82GlufsTer31	frameshift	Exon 4 of 4	ENSP00000301939.3	Q8N2U0
	TMEM256-PLSCR3	ENST00000573331.5	TSL:2	n.198+146_198+167delTTTTACTACCAGGCTCTGAGTG		intron	N/A	ENSP00000466104.1	K7ERE1
	TMEM256	ENST00000959765.1		c.292_313delTTTTACTACCAGGCTCTGAGTG	p.Phe98GlufsTer31	frameshift	Exon 4 of 4	ENSP00000629824.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Asphyxiating thoracic dystrophy 3 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs886039795; hg19: chr17-7306461;