rs886039795

Variant names:

• chr17-7403142-CCACTCAGAGCCTGGTAGTAAAA-C
• rs886039795
• NM_152766.5:c.244_265delTTTTACTACCAGGCTCTGAGTG

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The NM_152766.5(TMEM256):​c.244_265delTTTTACTACCAGGCTCTGAGTG​(p.Phe82GlufsTer31) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TMEM256 NM_152766.5 frameshift
• Clinical Significance: Likely pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 5.02
• Publications: 0 publications found

Genes affected

TMEM256 (HGNC:28618): (transmembrane protein 256) Located in extracellular exosome. [provided by Alliance of Genome Resources, Apr 2022]

TMEM256-PLSCR3 (HGNC:49186): (TMEM256-PLSCR3 readthrough (NMD candidate)) This locus represents naturally occurring read-through transcription between the neighboring chromosome 17 open reading frame 61 (C17orf61) and phospholipid scramblase 3 (PLSCR3) genes. The read-through transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Jan 2011]

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant 17-7403142-CCACTCAGAGCCTGGTAGTAAAA-C is Pathogenic according to our data. Variant chr17-7403142-CCACTCAGAGCCTGGTAGTAAAA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 266078.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TMEM256	NM_152766.5	c.244_265delTTTTACTACCAGGCTCTGAGTG	p.Phe82GlufsTer31	frameshift_variant	Exon 4 of 4	ENST00000302422.4	NP_689979.1
TMEM256-PLSCR3	NR_037719.1	n.164+494_164+515delTTTTACTACCAGGCTCTGAGTG		intron_variant	Intron 2 of 9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TMEM256	ENST00000302422.4	c.244_265delTTTTACTACCAGGCTCTGAGTG	p.Phe82GlufsTer31	frameshift_variant	Exon 4 of 4	1	NM_152766.5	ENSP00000301939.3
TMEM256-PLSCR3	ENST00000573331.5	n.198+146_198+167delTTTTACTACCAGGCTCTGAGTG		intron_variant	Intron 3 of 10	2		ENSP00000466104.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Asphyxiating thoracic dystrophy 3 Pathogenic:1

-

Genomic Medicine Center of Excellence, King Faisal Specialist Hospital and Research Centre

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: research

LOF, autozygosity mapping -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs886039795; hg19: chr17-7306461;