chr17-80220158-GGAGGAGGCCAGTGGCCACTTCCCCGGGCCACCGCAGGTGGGCGTGGGGGGGCGGCGCCGGCACTCACC-G

Variant names:

• chr17-80220158-GGAGGAGGCCAGTGGCCACTTCCCCGGGCCACCGCAGGTGGGCGTGGGGGGGCGGCGCCGGCACTCACC-G
• NM_000199.5:c.88_88+67delGGTGAGTGCCGGCGCCGCCCCCCCACGCCCACCTGCGGTGGCCCGGGGAAGTGGCCACTGGCCTCCTC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000199.5(SGSH):​c.88_88+67delGGTGAGTGCCGGCGCCGCCCCCCCACGCCCACCTGCGGTGGCCCGGGGAAGTGGCCACTGGCCTCCTC​(p.Ala30fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: SGSH NM_000199.5 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.26

Genes affected

SGSH (HGNC:10818): (N-sulfoglucosamine sulfohydrolase) This gene encodes the enzyme sulfamidase; one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with the lysosomal storage disease mucopolysaccaridosis IIIA, also known as Sanfilippo syndrome A, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined. [provided by RefSeq, Jun 2017]

SLC26A11 (HGNC:14471): (solute carrier family 26 member 11) This gene encodes a member of the solute linked carrier 26 family of anion exchangers. Members of this family of proteins are essential for numerous cellular functions including homeostasis and intracellular electrolyte balance. The encoded protein is a sodium independent sulfate transporter that is sensitive to the anion exchanger inhibitor 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 46 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-80220158-GGAGGAGGCCAGTGGCCACTTCCCCGGGCCACCGCAGGTGGGCGTGGGGGGGCGGCGCCGGCACTCACC-G is Pathogenic according to our data. Variant chr17-80220158-GGAGGAGGCCAGTGGCCACTTCCCCGGGCCACCGCAGGTGGGCGTGGGGGGGCGGCGCCGGCACTCACC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1068230.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SGSH	NM_000199.5	c.88_88+67delGGTGAGTGCCGGCGCCGCCCCCCCACGCCCACCTGCGGTGGCCCGGGGAAGTGGCCACTGGCCTCCTC	p.Ala30fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 1 of 8	ENST00000326317.11	NP_000190.1
SLC26A11	NM_001166347.2	c.-551_-484delGAGGAGGCCAGTGGCCACTTCCCCGGGCCACCGCAGGTGGGCGTGGGGGGGCGGCGCCGGCACTCACC		upstream_gene_variant		ENST00000361193.8	NP_001159819.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SGSH	ENST00000326317.11	c.88_88+67delGGTGAGTGCCGGCGCCGCCCCCCCACGCCCACCTGCGGTGGCCCGGGGAAGTGGCCACTGGCCTCCTC	p.Ala30fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 1 of 8	1	NM_000199.5	ENSP00000314606.6
SLC26A11	ENST00000361193.8	c.-551_-484delGAGGAGGCCAGTGGCCACTTCCCCGGGCCACCGCAGGTGGGCGTGGGGGGGCGGCGCCGGCACTCACC		upstream_gene_variant		1	NM_001166347.2	ENSP00000355384.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Mucopolysaccharidosis, MPS-III-A Pathogenic:1

Apr 01, 2020

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. Donor and acceptor splice site variants typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in SGSH are known to be pathogenic (PMID: 11182930, 21204211, 22976768). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with SGSH-related conditions. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This sequence change affects donor splice site in intron 1 of the SGSH gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-78193957;