chr17-80220158-GGAGGAGGCCAGTGGCCACTTCCCCGGGCCACCGCAGGTGGGCGTGGGGGGGCGGCGCCGGCACTCACC-G
Variant summary
Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000199.5(SGSH):c.88_88+67delGGTGAGTGCCGGCGCCGCCCCCCCACGCCCACCTGCGGTGGCCCGGGGAAGTGGCCACTGGCCTCCTC(p.Ala30fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A30A) has been classified as Uncertain significance.
Frequency
Consequence
NM_000199.5 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
SGSH | NM_000199.5 | c.88_88+67delGGTGAGTGCCGGCGCCGCCCCCCCACGCCCACCTGCGGTGGCCCGGGGAAGTGGCCACTGGCCTCCTC | p.Ala30fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 1 of 8 | ENST00000326317.11 | NP_000190.1 | |
SLC26A11 | NM_001166347.2 | c.-551_-484delGAGGAGGCCAGTGGCCACTTCCCCGGGCCACCGCAGGTGGGCGTGGGGGGGCGGCGCCGGCACTCACC | upstream_gene_variant | ENST00000361193.8 | NP_001159819.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
SGSH | ENST00000326317.11 | c.88_88+67delGGTGAGTGCCGGCGCCGCCCCCCCACGCCCACCTGCGGTGGCCCGGGGAAGTGGCCACTGGCCTCCTC | p.Ala30fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 1 of 8 | 1 | NM_000199.5 | ENSP00000314606.6 | ||
SLC26A11 | ENST00000361193.8 | c.-551_-484delGAGGAGGCCAGTGGCCACTTCCCCGGGCCACCGCAGGTGGGCGTGGGGGGGCGGCGCCGGCACTCACC | upstream_gene_variant | 1 | NM_001166347.2 | ENSP00000355384.3 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Mucopolysaccharidosis, MPS-III-A Pathogenic:1
In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. Donor and acceptor splice site variants typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in SGSH are known to be pathogenic (PMID: 11182930, 21204211, 22976768). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with SGSH-related conditions. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This sequence change affects donor splice site in intron 1 of the SGSH gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at