chr17-82093564-CACCCACCTCCGCAGGAGGCTGGGCAGG-C

Variant names:

• chr17-82093564-CACCCACCTCCGCAGGAGGCTGGGCAGG-C
• rs1555669393
• NM_004104.5:c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2 BP6_Moderate

The NM_004104.5(FASN):​c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely benign (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: FASN NM_004104.5 splice_region, intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.205

Genes affected

FASN (HGNC:3594): (fatty acid synthase) The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 17-82093564-CACCCACCTCCGCAGGAGGCTGGGCAGG-C is Benign according to our data. Variant chr17-82093564-CACCCACCTCCGCAGGAGGCTGGGCAGG-C is described in ClinVar as [Likely_benign]. Clinvar id is 462056.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
FASN	NM_004104.5	c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT		splice_region_variant, intron_variant	Intron 4 of 42	ENST00000306749.4	NP_004095.4
FASN	XM_011523538.3	c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT		splice_region_variant, intron_variant	Intron 4 of 42		XP_011521840.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
FASN	ENST00000306749.4	c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT		splice_region_variant, intron_variant	Intron 4 of 42	1	NM_004104.5	ENSP00000304592.2
FASN	ENST00000634990.1	c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT		splice_region_variant, intron_variant	Intron 4 of 42	5		ENSP00000488964.1
FASN	ENST00000635197.1	c.*10_*36delCCTGCCCAGCCTCCTGCGGAGGTGGGT		downstream_gene_variant		3		ENSP00000489514.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Epileptic encephalopathy Benign:1

Oct 03, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555669393; hg19: chr17-80051440;