rs1555669393

Variant names:

• chr17-82093564-CACCCACCTCCGCAGGAGGCTGGGCAGG-C
• rs1555669393
• NM_004104.5:c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_004104.5(FASN):​c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: FASN NM_004104.5 splice_region, intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.205
• Publications: 0 publications found

Genes affected

FASN (HGNC:3594): (fatty acid synthase) The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008]

FASN Gene-Disease associations (from GenCC):

• neurodevelopmental disorder

  Inheritance: AR Classification: LIMITED Submitted by: G2P

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 17-82093564-CACCCACCTCCGCAGGAGGCTGGGCAGG-C is Benign according to our data. Variant chr17-82093564-CACCCACCTCCGCAGGAGGCTGGGCAGG-C is described in ClinVar as Likely_benign. ClinVar VariationId is 462056.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004104.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FASN	NM_004104.5	MANE Select	c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT		splice_region intron	N/A	NP_004095.4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FASN	ENST00000306749.4	TSL:1 MANE Select	c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT		splice_region intron	N/A	ENSP00000304592.2	P49327
	FASN	ENST00000940344.1		c.461_481+6delCCTGCCCAGCCTCCTGCGGAGGTGGGT	p.Ser154_Gly161delinsTrp	splice_donor disruptive_inframe_deletion splice_region intron	Exon 4 of 43	ENSP00000610403.1
	FASN	ENST00000940346.1		c.454+7_454+33delCCTGCCCAGCCTCCTGCGGAGGTGGGT		splice_region intron	N/A	ENSP00000610405.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	Epileptic encephalopathy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.20

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555669393; hg19: chr17-80051440;