chr18-58044706-GAGGTGAGTGGCACCCCCTTCCTGCTCGGGACTCCCCGGGGAGTTCCTATCCCGCGCCGGCAGGGGGAGGGGAAAGGGGCCGTCCCCGGGGTGCTCGTGCCCAGCGTCTGCAGGGGAGCCCCAAAGCGGGAGCGCCCCGGAGCGGGATCCAGGGGAGCTTGGGTCCTTCCGCACCCCCCACCCTCCGCAAGCCGAGCTCATTGTTTGTAAATAAAGCGGCGCGACGCCCTTGGAGCTGGGGGTTCACTCCGCAGCTCCTCGCTTTCGGGAGGAGAGGGAGGGGGCATGCGTGCCTCTCTTCCCTCTTCCTCTCCAAGCAGCGTCTCCCGGGGCTGTTGGGCAACTTTCCGCCTCTCGCCCCTGC-G

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2

The NM_001144967.3(NEDD4L):​c.48+1_48+363del variant causes a splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

NEDD4L
NM_001144967.3 splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 3.67
Variant links:
Genes affected
NEDD4L (HGNC:7728): (NEDD4 like E3 ubiquitin protein ligase) This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.16495901 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
NEDD4LNM_001144967.3 linkc.48+1_48+363del splice_donor_variant, splice_region_variant, intron_variant Intron 1 of 30 ENST00000400345.8 NP_001138439.1 Q96PU5-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
NEDD4LENST00000400345.8 linkc.47_48+361del p.Glu16GlyfsTer840 frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant Exon 1 of 31 1 NM_001144967.3 ENSP00000383199.2 Q96PU5-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Apr 21, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change affects a splice site in intron 1 of the NEDD4L gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), however the current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in NEDD4L cause disease. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with NEDD4L-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the effect of this variant on mRNA splicing is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr18-55711938; API