chr19-10986535-T-TGGCCCTGGCCCCGGCCCGGGTCCC

Position:

• chr19-10986535-T-TGGCCCTGGCCCCGGCCCGGGTCCC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_003072.5(SMARCA4):​c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC​(p.Pro244_Ala245insGlyProGlyProGlyProGlyPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000197 in 152,142 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000036 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: SMARCA4 NM_003072.5 disruptive_inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:3 B:1
• Conservation: PhyloP100: 3.52

Genes affected

SMARCA4 (HGNC:11100): (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4) The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]

SMARCA4 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SMARCA4	NM_001387283.1	c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC	p.Pro244_Ala245insGlyProGlyProGlyProGlyPro	disruptive_inframe_insertion	4/36	ENST00000646693.2	NP_001374212.1
SMARCA4	NM_003072.5	c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC	p.Pro244_Ala245insGlyProGlyProGlyProGlyPro	disruptive_inframe_insertion	4/35	ENST00000344626.10	NP_003063.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SMARCA4	ENST00000646693.2	c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC	p.Pro244_Ala245insGlyProGlyProGlyProGlyPro	disruptive_inframe_insertion	4/36		NM_001387283.1	ENSP00000495368.1
SMARCA4	ENST00000344626.10	c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC	p.Pro244_Ala245insGlyProGlyProGlyProGlyPro	disruptive_inframe_insertion	4/35	1	NM_003072.5	ENSP00000343896.4
SMARCA4	ENST00000643549.1	c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC	p.Pro244_Ala245insGlyProGlyProGlyProGlyPro	disruptive_inframe_insertion	4/35			ENSP00000493975.1
SMARCA4	ENST00000541122.6	c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC	p.Pro244_Ala245insGlyProGlyProGlyProGlyPro	disruptive_inframe_insertion	5/35	5		ENSP00000445036.2
SMARCA4	ENST00000643296.1	c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC	p.Pro244_Ala245insGlyProGlyProGlyProGlyPro	disruptive_inframe_insertion	4/34			ENSP00000496635.1
SMARCA4	ENST00000644737.1	c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC	p.Pro244_Ala245insGlyProGlyProGlyProGlyPro	disruptive_inframe_insertion	4/34			ENSP00000495548.1
SMARCA4	ENST00000589677.5	c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC	p.Pro244_Ala245insGlyProGlyProGlyProGlyPro	disruptive_inframe_insertion	5/35	5		ENSP00000464778.1
SMARCA4	ENST00000643995.1	c.120_143dupTGGCCCCGGCCCGGGTCCCGGCCC	p.Pro48_Ala49insGlyProGlyProGlyProGlyPro	disruptive_inframe_insertion	1/32			ENSP00000496004.1

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152142 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000360 AC: 5 AN: 1389190 Hom.: 0 Cov.: 34 AF XY: 0.00000292 AC XY: 2 AN XY: 685600

Gnomad4 AFR exome AF: 0.0000317

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000280

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000278

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 152142 Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1 AN XY: 74310

Gnomad4 AFR AF: 0.0000241

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000294

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:3 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Hereditary cancer-predisposing syndrome Uncertain:1 Benign:1

Uncertain significance, criteria provided, single submitter	curation	Sema4, Sema4	Apr 10, 2021	- -
Likely benign, criteria provided, single submitter	clinical testing	Ambry Genetics	Apr 29, 2021	This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Rhabdoid tumor predisposition syndrome 2 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 22, 2024

This variant, c.708_731dup, results in the insertion of 8 amino acid(s) of the SMARCA4 protein (p.Gly237_Pro244dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with SMARCA4-related conditions. ClinVar contains an entry for this variant (Variation ID: 408615). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

May 26, 2024

In-frame insertion of 8 amino acids in a repetitive region with no known function; Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555753690; hg19: chr19-11097211;