chr19-10986535-T-TGGCCCTGGCCCCGGCCCGGGTCCC
Variant summary
Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP3BP6
The NM_003072.5(SMARCA4):c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC(p.Pro244_Ala245insGlyProGlyProGlyProGlyPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000197 in 152,142 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. P244P) has been classified as Likely benign.
Frequency
Consequence
NM_003072.5 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Coffin-Siris syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen, Illumina
- intellectual disability, autosomal dominant 16Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- rhabdoid tumor predisposition syndrome 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Genomics England PanelApp, ClinGen, Labcorp Genetics (formerly Invitae)
- otosclerosisInheritance: AD Classification: STRONG Submitted by: PanelApp Australia
- uterine corpus sarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- familial rhabdoid tumorInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary nonpolyposis colon cancerInheritance: Unknown Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003072.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMARCA4 | MANE Plus Clinical | c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC | p.Pro244_Ala245insGlyProGlyProGlyProGlyPro | disruptive_inframe_insertion | Exon 4 of 36 | NP_001374212.1 | Q9HBD4 | ||
| SMARCA4 | MANE Select | c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC | p.Pro244_Ala245insGlyProGlyProGlyProGlyPro | disruptive_inframe_insertion | Exon 4 of 35 | NP_003063.2 | |||
| SMARCA4 | c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC | p.Pro244_Ala245insGlyProGlyProGlyProGlyPro | disruptive_inframe_insertion | Exon 4 of 36 | NP_001122321.1 | Q9HBD4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMARCA4 | MANE Plus Clinical | c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC | p.Pro244_Ala245insGlyProGlyProGlyProGlyPro | disruptive_inframe_insertion | Exon 4 of 36 | ENSP00000495368.1 | Q9HBD4 | ||
| SMARCA4 | TSL:1 MANE Select | c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC | p.Pro244_Ala245insGlyProGlyProGlyProGlyPro | disruptive_inframe_insertion | Exon 4 of 35 | ENSP00000343896.4 | P51532-1 | ||
| SMARCA4 | c.708_731dupTGGCCCCGGCCCGGGTCCCGGCCC | p.Pro244_Ala245insGlyProGlyProGlyProGlyPro | disruptive_inframe_insertion | Exon 4 of 35 | ENSP00000493975.1 | A0A2R8Y4P4 |
Frequencies
GnomAD3 genomes AF: 0.0000197 AC: 3AN: 152142Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000360 AC: 5AN: 1389190Hom.: 0 Cov.: 34 AF XY: 0.00000292 AC XY: 2AN XY: 685600 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000197 AC: 3AN: 152142Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1AN XY: 74310 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at