chr19-15161141-GCAGGCCCAGGCTGAGTACACATCCTC-G

Variant names:

• chr19-15161141-GCAGGCCCAGGCTGAGTACACATCCTC-G
• rs869312909
• NM_000435.3:c.6461_6486delGAGGATGTGTACTCAGCCTGGGCCTG

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_Strong PP5_Moderate

The NM_000435.3(NOTCH3):​c.6461_6486delGAGGATGTGTACTCAGCCTGGGCCTG​(p.Gly2154AlafsTer79) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: NOTCH3 NM_000435.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2 O:1
• Conservation: PhyloP100: 5.12
• Publications: 2 publications found

Genes affected

NOTCH3 (HGNC:7883): (notch receptor 3) This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]

NOTCH3 Gene-Disease associations (from GenCC):

• cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 1

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Laboratory for Molecular Medicine, Orphanet, Labcorp Genetics (formerly Invitae)
• lateral meningocele syndrome

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
• infantile myofibromatosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• myofibromatosis, infantile, 2

  Inheritance: AD Classification: LIMITED Submitted by: G2P
• pulmonary arterial hypertension

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 10 pathogenic variants in the truncated region.
• PP5: Variant 19-15161141-GCAGGCCCAGGCTGAGTACACATCCTC-G is Pathogenic according to our data. Variant chr19-15161141-GCAGGCCCAGGCTGAGTACACATCCTC-G is described in ClinVar as [Pathogenic]. Clinvar id is 224880.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NOTCH3	NM_000435.3	c.6461_6486delGAGGATGTGTACTCAGCCTGGGCCTG	p.Gly2154AlafsTer79	frameshift_variant	Exon 33 of 33	ENST00000263388.7	NP_000426.2
NOTCH3	XM_005259924.5	c.6305_6330delGAGGATGTGTACTCAGCCTGGGCCTG	p.Gly2102AlafsTer79	frameshift_variant	Exon 32 of 32		XP_005259981.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NOTCH3	ENST00000263388.7	c.6461_6486delGAGGATGTGTACTCAGCCTGGGCCTG	p.Gly2154AlafsTer79	frameshift_variant	Exon 33 of 33	1	NM_000435.3	ENSP00000263388.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2 Other:1

Revision: criteria provided, single submitter

Submissions by phenotype

Lateral meningocele syndrome Pathogenic:2 Other:1

-

GeneReviews

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Feb 01, 2015

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

-

Baylor-Hopkins Center for Mendelian Genomics, Johns Hopkins University School of Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.1
Mutation Taster		=6/194	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs869312909; hg19: chr19-15271952;