rs869312909
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_StrongPP5_Moderate
The NM_000435.3(NOTCH3):c.6461_6486delGAGGATGTGTACTCAGCCTGGGCCTG(p.Gly2154AlafsTer79) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_000435.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 1Inheritance: AD, AR Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
- lateral meningocele syndromeInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
- infantile myofibromatosisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- myofibromatosis, infantile, 2Inheritance: AD Classification: LIMITED Submitted by: G2P
- pulmonary arterial hypertensionInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000435.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| NOTCH3 | TSL:1 MANE Select | c.6461_6486delGAGGATGTGTACTCAGCCTGGGCCTG | p.Gly2154AlafsTer79 | frameshift | Exon 33 of 33 | ENSP00000263388.1 | Q9UM47 | ||
| NOTCH3 | c.6596_6621delGAGGATGTGTACTCAGCCTGGGCCTG | p.Gly2199AlafsTer79 | frameshift | Exon 34 of 34 | ENSP00000601593.1 | ||||
| NOTCH3 | c.6284_6309delGAGGATGTGTACTCAGCCTGGGCCTG | p.Gly2095AlafsTer79 | frameshift | Exon 32 of 32 | ENSP00000601591.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.