rs869312909

Positions:

• chr19-15161141-GCAGGCCCAGGCTGAGTACACATCCTC-G

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Moderate PM2 PP5_Moderate

The NM_000435.3(NOTCH3):​c.6461_6486delGAGGATGTGTACTCAGCCTGGGCCTG​(p.Gly2154fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: NOTCH3 NM_000435.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2 O:1
• Conservation: PhyloP100: 5.12

Genes affected

NOTCH3 (HGNC:7883): (notch receptor 3) This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0725 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 19-15161141-GCAGGCCCAGGCTGAGTACACATCCTC-G is Pathogenic according to our data. Variant chr19-15161141-GCAGGCCCAGGCTGAGTACACATCCTC-G is described in ClinVar as [Pathogenic]. Clinvar id is 224880.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
NOTCH3	NM_000435.3	c.6461_6486delGAGGATGTGTACTCAGCCTGGGCCTG	p.Gly2154fs	frameshift_variant	33/33	ENST00000263388.7	NP_000426.2
NOTCH3	XM_005259924.5	c.6305_6330delGAGGATGTGTACTCAGCCTGGGCCTG	p.Gly2102fs	frameshift_variant	32/32		XP_005259981.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
NOTCH3	ENST00000263388.7	c.6461_6486delGAGGATGTGTACTCAGCCTGGGCCTG	p.Gly2154fs	frameshift_variant	33/33	1	NM_000435.3	ENSP00000263388.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2 Other:1

Revision: criteria provided, single submitter

Submissions by phenotype

Lateral meningocele syndrome Pathogenic:2 Other:1

Pathogenic, no assertion criteria provided	literature only	OMIM	Feb 01, 2015	- -
Pathogenic, criteria provided, single submitter	research	Baylor-Hopkins Center for Mendelian Genomics, Johns Hopkins University School of Medicine	-	- -
not provided, no classification provided	literature only	GeneReviews	-	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs869312909; hg19: chr19-15271952;