chr19-40396791-G-GTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTC

Variant names:

• chr19-40396791-G-GTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTC
• rs1555801137
• NM_181882.3:c.1483_1560dupGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_181882.3(PRX):​c.1483_1560dupGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA​(p.Val520_Gln521insGluLeuProLysValSerGluMetLysLeuProLysValProGluMetAlaValProGluValArgLeuProGluVal) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: PRX NM_181882.3 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: -0.740
• Publications: 0 publications found

Genes affected

PRX (HGNC:13797): (periaxin) This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]

PRX Gene-Disease associations (from GenCC):

• Charcot-Marie-Tooth disease type 4

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Charcot-Marie-Tooth disease type 4F

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
• Charcot-Marie-Tooth disease type 3

  Inheritance: AD, AR Classification: MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_181882.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PRX	NM_181882.3	c.1483_1560dupGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Val520_Gln521insGluLeuProLysValSerGluMetLysLeuProLysValProGluMetAlaValProGluValArgLeuProGluVal	conservative_inframe_insertion	Exon 7 of 7	ENST00000324001.8	NP_870998.2
PRX	NM_001411127.1	c.1768_1845dupGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Val615_Gln616insGluLeuProLysValSerGluMetLysLeuProLysValProGluMetAlaValProGluValArgLeuProGluVal	conservative_inframe_insertion	Exon 7 of 7		NP_001398056.1
PRX	XM_017027047.2	c.1381_1458dupGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Val486_Gln487insGluLeuProLysValSerGluMetLysLeuProLysValProGluMetAlaValProGluValArgLeuProGluVal	conservative_inframe_insertion	Exon 4 of 4		XP_016882536.1
PRX	NM_020956.2	c.*1688_*1765dupGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA		3_prime_UTR_variant	Exon 6 of 6		NP_066007.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PRX	ENST00000324001.8	c.1483_1560dupGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Val520_Gln521insGluLeuProLysValSerGluMetLysLeuProLysValProGluMetAlaValProGluValArgLeuProGluVal	conservative_inframe_insertion	Exon 7 of 7	1	NM_181882.3	ENSP00000326018.6

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 36

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Uncertain:1

Jan 10, 2025

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Not observed at significant frequency in large population cohorts (gnomAD); In-frame duplication of 26 amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge

Charcot-Marie-Tooth disease type 4 Uncertain:1

Sep 09, 2019

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Experimental studies and prediction algorithms are not available or were not evaluated for this variant, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with PRX-related conditions. This variant is not present in population databases (ExAC no frequency). This variant, c.1483_1560dup, results in the insertion of 26 amino acid(s) to the PRX protein (p.Glu495_Val520dup), but otherwise preserves the integrity of the reading frame.

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.74

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555801137; hg19: chr19-40902698;