rs1555801137

Variant names:

• chr19-40396791-GTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTC-G
• rs1555801137
• NM_181882.3:c.1483_1560delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA

Your query was ambiguous. Multiple possible variants found:

• chr19-40396791-GTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTC-G
• chr19-40396791-GTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTC-GTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTCTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_181882.3(PRX):​c.1483_1560delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA​(p.Glu495_Val520del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000422 in 142,240 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: 𝑓 0.000042 (0 hom., cov: 32)
• Consequence: PRX NM_181882.3 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 2.15
• Publications: 0 publications found

Genes affected

PRX (HGNC:13797): (periaxin) This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]

PRX Gene-Disease associations (from GenCC):

• Charcot-Marie-Tooth disease type 4

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Charcot-Marie-Tooth disease type 4F

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
• Charcot-Marie-Tooth disease type 3

  Inheritance: AD, AR Classification: MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_181882.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PRX	NM_181882.3	c.1483_1560delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Glu495_Val520del	conservative_inframe_deletion	Exon 7 of 7	ENST00000324001.8	NP_870998.2
PRX	NM_001411127.1	c.1768_1845delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Glu590_Val615del	conservative_inframe_deletion	Exon 7 of 7		NP_001398056.1
PRX	XM_017027047.2	c.1381_1458delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Glu461_Val486del	conservative_inframe_deletion	Exon 4 of 4		XP_016882536.1
PRX	NM_020956.2	c.*1688_*1765delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA		3_prime_UTR_variant	Exon 6 of 6		NP_066007.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PRX	ENST00000324001.8	c.1483_1560delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Glu495_Val520del	conservative_inframe_deletion	Exon 7 of 7	1	NM_181882.3	ENSP00000326018.6

Frequencies

GnomAD3 genomes AF: 0.0000422 AC: 6 AN: 142240 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000533

Gnomad AMI AF: 0.00243

Gnomad AMR AF: 0.0000695

Gnomad ASJ AF: 0.000300

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000400 AC: 1 AN: 250052 AF XY: 0.00000739

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.000164

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0000422 AC: 6 AN: 142240 Hom.: 0 Cov.: 32 AF XY: 0.0000578 AC XY: 4 AN XY: 69172

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000533 AC: 2 AN: 37540

American (AMR) AF: 0.0000695 AC: 1 AN: 14386

Ashkenazi Jewish (ASJ) AF: 0.000300 AC: 1 AN: 3332

East Asian (EAS) AF: 0.00 AC: 0 AN: 4796

South Asian (SAS) AF: 0.00 AC: 0 AN: 4456

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9634

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 264

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 65062

Other (OTH) AF: 0.00 AC: 0 AN: 1946

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.000111 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Inborn genetic diseases Uncertain:1

Nov 25, 2021

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1483_1560del78 variant (also known as p.E495_V520del) is located in coding exon 4 of the PRX gene. This variant results from an in-frame deletion of 78 nucleotides at nucleotide positions 1483 to 1560. This results in the deletion of 26 amino acids between codons 495 and 520. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Charcot-Marie-Tooth disease type 4F Uncertain:1

Apr 27, 2019

Genomic Research Center, Shahid Beheshti University of Medical Sciences

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Uncertain:1

Jun 13, 2025

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Reported previously as a variant of uncertain significance in a cohort of patients with suspected Charcot-Marie-Tooth disease; however, no further clinical information was provided (PMID: 32376792); Not observed at significant frequency in large population cohorts (gnomAD); In-frame deletion of 26 amino acid(s) in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: (PMID: 32376792) -

Charcot-Marie-Tooth disease type 4 Uncertain:1

Aug 17, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 410606). This variant has been observed in individual(s) with Charcot-Marie-Tooth disease (PMID: 32376792). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant, c.1483_1560del, results in the deletion of 26 amino acid(s) of the PRX protein (p.Glu495_Val520del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=82/118	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555801137; hg19: chr19-40902698;