rs1555801137

Variant names:

• chr19-40396791-GTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTC-G
• rs1555801137
• NM_181882.3:c.1483_1560delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA

Your query was ambiguous. Multiple possible variants found:

• chr19-40396791-GTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTC-G
• chr19-40396791-GTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTC-GTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTCTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_181882.3(PRX):​c.1483_1560delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA​(p.Glu495_Val520del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000422 in 142,240 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: 𝑓 0.000042 (0 hom., cov: 32)
• Consequence: PRX NM_181882.3 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 2.15

Genes affected

PRX (HGNC:13797): (periaxin) This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_181882.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PRX	NM_181882.3	c.1483_1560delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Glu495_Val520del	conservative_inframe_deletion	Exon 7 of 7	ENST00000324001.8	NP_870998.2
PRX	NM_001411127.1	c.1768_1845delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Glu590_Val615del	conservative_inframe_deletion	Exon 7 of 7		NP_001398056.1
PRX	XM_017027047.2	c.1381_1458delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Glu461_Val486del	conservative_inframe_deletion	Exon 4 of 4		XP_016882536.1
PRX	NM_020956.2	c.*1688_*1765delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA		3_prime_UTR_variant	Exon 6 of 6		NP_066007.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PRX	ENST00000324001.8	c.1483_1560delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Glu495_Val520del	conservative_inframe_deletion	Exon 7 of 7	1	NM_181882.3	ENSP00000326018.6

Frequencies

GnomAD3 genomes AF: 0.0000422 AC: 6 AN: 142240 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000533

Gnomad AMI AF: 0.00243

Gnomad AMR AF: 0.0000695

Gnomad ASJ AF: 0.000300

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0000422 AC: 6 AN: 142240 Hom.: 0 Cov.: 32 AF XY: 0.0000578 AC XY: 4 AN XY: 69172

Gnomad4 AFR AF: 0.0000533

Gnomad4 AMR AF: 0.0000695

Gnomad4 ASJ AF: 0.000300

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000111 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Inborn genetic diseases Uncertain:1

Nov 25, 2021

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1483_1560del78 variant (also known as p.E495_V520del) is located in coding exon 4 of the PRX gene. This variant results from an in-frame deletion of 78 nucleotides at nucleotide positions 1483 to 1560. This results in the deletion of 26 amino acids between codons 495 and 520. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

not provided Uncertain:1

Jan 31, 2018

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

A variant of uncertain significance has been identified in the PRX gene. The c.1483_1560del78 variant has not been published as a pathogenic variant, nor has it been reported as a benign variant to our knowledge. The c.1483_1560del78 variant is not observed in large population cohorts (Lek et al., 2016; 1000 Genomes Consortium et al., 2015; Exome Variant Server). The c.1483_1560del78 variant results in an in-frame deletion of 26 amino acids, denoted p.Glu495_Val520del. In-frame deletions of the PRX gene have not been previously reported in association with neuropathy to our knowledge (Stenson et al., 2014). Therefore, based on the currently available information, it is unclear whether this variant is a pathogenic variant or a rare benign variant. -

Charcot-Marie-Tooth disease type 4F Uncertain:1

Apr 27, 2019

Genomic Research Center, Shahid Beheshti University of Medical Sciences

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Charcot-Marie-Tooth disease type 4 Uncertain:1

Aug 17, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 410606). This variant has been observed in individual(s) with Charcot-Marie-Tooth disease (PMID: 32376792). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant, c.1483_1560del, results in the deletion of 26 amino acid(s) of the PRX protein (p.Glu495_Val520del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555801137; hg19: chr19-40902698;