chr19-40396791-GTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTC-G

Variant names:

• chr19-40396791-GTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTTGGGAGTTTCATCTCTGACACTTTGGGCAGCTC-G
• rs1555801137
• NM_181882.3:c.1483_1560delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_181882.3(PRX):​c.1483_1560delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA​(p.Glu495_Val520del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000422 in 142,240 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: 𝑓 0.000042 (0 hom., cov: 32)
• Consequence: PRX NM_181882.3 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 2.15
• Publications: 0 publications found

Genes affected

PRX (HGNC:13797): (periaxin) This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]

PRX Gene-Disease associations (from GenCC):

• Charcot-Marie-Tooth disease type 4

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Charcot-Marie-Tooth disease type 4F

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet
• Charcot-Marie-Tooth disease type 3

  Inheritance: AD, AR Classification: MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_181882.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_181882.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PRX	NM_181882.3	MANE Select	c.1483_1560delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Glu495_Val520del	conservative_inframe_deletion	Exon 7 of 7	NP_870998.2	Q9BXM0-1
	PRX	NM_001411127.1		c.1768_1845delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Glu590_Val615del	conservative_inframe_deletion	Exon 7 of 7	NP_001398056.1	A0A669KBF1
	PRX	NM_020956.2		c.*1688_*1765delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA		3_prime_UTR	Exon 6 of 6	NP_066007.1	Q9BXM0-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PRX	ENST00000324001.8	TSL:1 MANE Select	c.1483_1560delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Glu495_Val520del	conservative_inframe_deletion	Exon 7 of 7	ENSP00000326018.6	Q9BXM0-1
	PRX	ENST00000291825.11	TSL:1	c.*1688_*1765delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA		3_prime_UTR	Exon 6 of 6	ENSP00000291825.6	Q9BXM0-2
	PRX	ENST00000674005.2		c.1768_1845delGAGCTGCCCAAAGTGTCAGAGATGAAACTCCCAAAGGTGCCAGAGATGGCTGTGCCGGAGGTGCGGCTTCCAGAGGTA	p.Glu590_Val615del	conservative_inframe_deletion	Exon 7 of 7	ENSP00000501261.1	A0A669KBF1

Frequencies

GnomAD3 genomes AF: 0.0000422 AC: 6 AN: 142240 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000533

Gnomad AMI AF: 0.00243

Gnomad AMR AF: 0.0000695

Gnomad ASJ AF: 0.000300

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000400 AC: 1 AN: 250052 AF XY: 0.00000739

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.000164

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0000422 AC: 6 AN: 142240 Hom.: 0 Cov.: 32 AF XY: 0.0000578 AC XY: 4 AN XY: 69172

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000533 AC: 2 AN: 37540

American (AMR) AF: 0.0000695 AC: 1 AN: 14386

Ashkenazi Jewish (ASJ) AF: 0.000300 AC: 1 AN: 3332

East Asian (EAS) AF: 0.00 AC: 0 AN: 4796

South Asian (SAS) AF: 0.00 AC: 0 AN: 4456

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9634

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 264

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 65062

Other (OTH) AF: 0.00 AC: 0 AN: 1946

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.000111 Hom.: 0

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Charcot-Marie-Tooth disease type 4 (1)
-	1	-	Charcot-Marie-Tooth disease type 4F (1)
-	1	-	Inborn genetic diseases (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=82/118	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555801137; hg19: chr19-40902698;