chr19-49201994-CGGAGCCCGGCTTCTGGGCACACCCTCCT-C
Variant summary
Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP6BS2
The NM_017636.4(TRPM4):c.2987_3014delAGCCCGGCTTCTGGGCACACCCTCCTGG(p.Glu996GlyfsTer118) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000837 in 1,613,806 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_017636.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -5 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000657 AC: 10AN: 152178Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.000164 AC: 41AN: 250516Hom.: 0 AF XY: 0.000177 AC XY: 24AN XY: 135508
GnomAD4 exome AF: 0.0000855 AC: 125AN: 1461510Hom.: 1 AF XY: 0.0000894 AC XY: 65AN XY: 727078
GnomAD4 genome AF: 0.0000657 AC: 10AN: 152296Hom.: 0 Cov.: 32 AF XY: 0.0000940 AC XY: 7AN XY: 74460
ClinVar
Submissions by phenotype
Progressive familial heart block type IB Uncertain:1Benign:1
- -
- -
not provided Uncertain:1
Reported in an individual with DCM and sick sinus syndrome and in an individual with atrioventricular nodal reentry tachycardia; described as c.2985_3012del in both cases (Li et al., 2020; Luo et al., 2020); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene or region of a gene for which loss of function is not a well-established mechanism of disease; This variant is associated with the following publications: (PMID: 32508047, 31521807) -
Cardiovascular phenotype Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at