rs765535147

Variant names:

• chr19-49201994-CGGAGCCCGGCTTCTGGGCACACCCTCCT-C
• rs765535147
• NM_017636.4:c.2987_3014delAGCCCGGCTTCTGGGCACACCCTCCTGG

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP6 BS2

The NM_017636.4(TRPM4):​c.2987_3014delAGCCCGGCTTCTGGGCACACCCTCCTGG​(p.Glu996GlyfsTer118) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000837 in 1,613,806 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000086 (1 hom.)
• Consequence: TRPM4 NM_017636.4 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:2 B:2
• Conservation: PhyloP100: 3.90

Genes affected

TRPM4 (HGNC:17993): (transient receptor potential cation channel subfamily M member 4) The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP6: Variant 19-49201994-CGGAGCCCGGCTTCTGGGCACACCCTCCT-C is Benign according to our data. Variant chr19-49201994-CGGAGCCCGGCTTCTGGGCACACCCTCCT-C is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 225503.We mark this variant Likely_benign, oryginal submissions are: {Uncertain_significance=2, Likely_benign=2}.
• BS2: High AC in GnomAd4 at 10 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TRPM4	NM_017636.4	c.2987_3014delAGCCCGGCTTCTGGGCACACCCTCCTGG	p.Glu996GlyfsTer118	frameshift_variant	Exon 20 of 25	ENST00000252826.10	NP_060106.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TRPM4	ENST00000252826.10	c.2987_3014delAGCCCGGCTTCTGGGCACACCCTCCTGG	p.Glu996GlyfsTer118	frameshift_variant	Exon 20 of 25	1	NM_017636.4	ENSP00000252826.4

Frequencies

GnomAD3 genomes AF: 0.0000657 AC: 10 AN: 152178 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00154

Gnomad SAS AF: 0.000415

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000164 AC: 41 AN: 250516 Hom.: 0 AF XY: 0.000177 AC XY: 24 AN XY: 135508

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000289

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00207

Gnomad SAS exome AF: 0.0000653

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000855 AC: 125 AN: 1461510 Hom.: 1 AF XY: 0.0000894 AC XY: 65 AN XY: 727078

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000224

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00264

Gnomad4 SAS exome AF: 0.000162

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.0000828

GnomAD4 genome AF: 0.0000657 AC: 10 AN: 152296 Hom.: 0 Cov.: 32 AF XY: 0.0000940 AC XY: 7 AN XY: 74460

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00155

Gnomad4 SAS AF: 0.000415

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

Bravo AF: 0.0000567

Asia WGS AF: 0.000577 AC: 2 AN: 3478

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:2 Benign:2

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Progressive familial heart block type IB Uncertain:1 Benign:1

Mar 18, 2016

Soonchunhyang University Bucheon Hospital, Soonchunhyang University Medical Center

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: reference population

- -

Oct 23, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Uncertain:1

Feb 01, 2023

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Reported in an individual with DCM and sick sinus syndrome and in an individual with atrioventricular nodal reentry tachycardia; described as c.2985_3012del in both cases (Li et al., 2020; Luo et al., 2020); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene or region of a gene for which loss of function is not a well-established mechanism of disease; This variant is associated with the following publications: (PMID: 32508047, 31521807) -

Cardiovascular phenotype Benign:1

Sep 26, 2019

Ambry Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs765535147; hg19: chr19-49705251;