chr19-49862713-ATGGATATGGGCGTGCCGTCGT-A

Variant names:

• chr19-49862713-ATGGATATGGGCGTGCCGTCGT-A
• rs1555811217
• NM_007254.4:c.821_841delACGACGGCACGCCCATATCCA

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_007254.4(PNKP):​c.821_841delACGACGGCACGCCCATATCCA​(p.Asn274_Ser280del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,822 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: PNKP NM_007254.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 2.02

Genes affected

PNKP (HGNC:9154): (polynucleotide kinase 3'-phosphatase) This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay.[provided by RefSeq, Sep 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_007254.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PNKP	NM_007254.4	c.821_841delACGACGGCACGCCCATATCCA	p.Asn274_Ser280del	disruptive_inframe_deletion	Exon 9 of 17	ENST00000322344.8	NP_009185.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PNKP	ENST00000322344.8	c.821_841delACGACGGCACGCCCATATCCA	p.Asn274_Ser280del	disruptive_inframe_deletion	Exon 9 of 17	1	NM_007254.4	ENSP00000323511.2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1461822 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 727222

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000224

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.0000166

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Inborn genetic diseases Uncertain:1

Jan 09, 2017

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.821_841del21 variant (also known as p.N274_S280del) is located in coding exon 8 of the PNKP gene. This variant results from an in-frame ACGACGGCACGCCCATATCCA deletion at nucleotide positions 821 to 841. This results in the deletion of 7 residues between codons 274 and 280.These amino acid positions are not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Developmental and epileptic encephalopathy, 12 Uncertain:1

Jul 12, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.821_841del, results in the deletion of 7 amino acid(s) of the PNKP protein (p.Asn274_Ser280del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with PNKP-related conditions. ClinVar contains an entry for this variant (Variation ID: 538887). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555811217; hg19: chr19-50365970;