rs1555811217
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_007254.4(PNKP):c.821_841delACGACGGCACGCCCATATCCA(p.Asn274_Ser280del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,822 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. N274N) has been classified as Likely benign.
Frequency
Consequence
NM_007254.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- ataxia - oculomotor apraxia type 4Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, G2P, Orphanet
- microcephaly, seizures, and developmental delayInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen
- Charcot-Marie-Tooth disease type 2B2Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
- genetic developmental and epileptic encephalopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_007254.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PNKP | TSL:1 MANE Select | c.821_841delACGACGGCACGCCCATATCCA | p.Asn274_Ser280del | disruptive_inframe_deletion | Exon 9 of 17 | ENSP00000323511.2 | Q96T60-1 | ||
| PNKP | TSL:1 | c.821_841delACGACGGCACGCCCATATCCA | p.Asn274_Ser280del | disruptive_inframe_deletion | Exon 8 of 16 | ENSP00000472300.1 | Q96T60-1 | ||
| PNKP | TSL:1 | n.*748_*768delACGACGGCACGCCCATATCCA | non_coding_transcript_exon | Exon 8 of 16 | ENSP00000468896.1 | M0QX49 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 0.00000137 AC: 2AN: 1461822Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 727222 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at