rs1555811217
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_007254.4(PNKP):βc.821_841delβ(p.Asn274_Ser280del) variant causes a inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,822 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (β β ). Synonymous variant affecting the same amino acid position (i.e. N274N) has been classified as Likely benign.
Frequency
Consequence
NM_007254.4 inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | UniProt |
---|---|---|---|---|---|---|---|
PNKP | NM_007254.4 | c.821_841del | p.Asn274_Ser280del | inframe_deletion | 9/17 | ENST00000322344.8 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|
PNKP | ENST00000322344.8 | c.821_841del | p.Asn274_Ser280del | inframe_deletion | 9/17 | 1 | NM_007254.4 | P1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 0.00000137 AC: 2AN: 1461822Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 727222
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Inborn genetic diseases Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Ambry Genetics | Jan 09, 2017 | The c.821_841del21 variant (also known as p.N274_S280del) is located in coding exon 8 of the PNKP gene. This variant results from an in-frame ACGACGGCACGCCCATATCCA deletion at nucleotide positions 821 to 841. This results in the deletion of 7 residues between codons 274 and 280.These amino acid positions are not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. - |
Developmental and epileptic encephalopathy, 12 Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Invitae | Jul 12, 2022 | This variant, c.821_841del, results in the deletion of 7 amino acid(s) of the PNKP protein (p.Asn274_Ser280del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with PNKP-related conditions. ClinVar contains an entry for this variant (Variation ID: 538887). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. - |
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at