chr19-55154064-TGGGCCCGCAGGTCCAGGGACTCCTTAGCCC-T

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3

The NM_000363.5(TNNI3):​c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC​(p.Arg162_Ala171del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. R162R) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 31)

Consequence

TNNI3
NM_000363.5 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 9.88

Publications

0 publications found
Variant links:
Genes affected
TNNI3 (HGNC:11947): (troponin I3, cardiac type) Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. This gene encodes the TnI-cardiac protein and is exclusively expressed in cardiac muscle tissues. Mutations in this gene cause familial hypertrophic cardiomyopathy type 7 (CMH7) and familial restrictive cardiomyopathy (RCM). Troponin I is useful in making a diagnosis of heart failure, and of ischemic heart disease. An elevated level of troponin is also now used as indicator of acute myocardial injury in patients hospitalized with moderate/severe Coronavirus Disease 2019 (COVID-19). Such elevation has also been associated with higher risk of mortality in cardiovascular disease patients hospitalized due to COVID-19. [provided by RefSeq, Aug 2020]
TNNI3 Gene-Disease associations (from GenCC):
  • hypertrophic cardiomyopathy
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • dilated cardiomyopathy 2A
    Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
  • hypertrophic cardiomyopathy 7
    Inheritance: AR, AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P
  • cardiomyopathy, familial restrictive, 1
    Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • dilated cardiomyopathy 1FF
    Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • dilated cardiomyopathy
    Inheritance: AD Classification: MODERATE Submitted by: ClinGen
  • familial isolated dilated cardiomyopathy
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • familial isolated restrictive cardiomyopathy
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • arrhythmogenic right ventricular cardiomyopathy
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

PM1
In a hotspot region, there are 10 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 20 uncertain in NM_000363.5
PM4
Nonframeshift variant in NON repetitive region in NM_000363.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TNNI3NM_000363.5 linkc.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC p.Arg162_Ala171del disruptive_inframe_deletion Exon 7 of 8 ENST00000344887.10 NP_000354.4

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TNNI3ENST00000344887.10 linkc.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC p.Arg162_Ala171del disruptive_inframe_deletion Exon 7 of 8 1 NM_000363.5 ENSP00000341838.5

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hypertrophic cardiomyopathy Uncertain:1
Jan 22, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant, c.485_514del, results in the deletion of 10 amino acid(s) of the TNNI3 protein (p.Arg162_Ala171del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of TNNI3-related conditions (Invitae). ClinVar contains an entry for this variant (Variation ID: 454407). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant disrupts the p.Arg170, p.Arg162 amino acid residue in TNNI3. Other variant(s) that disrupt this residue have been determined to be pathogenic (PMID: 15607392, 20031618, 22876777, 26440512). This suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555863489; hg19: chr19-55665432; API