rs1555863489
Variant summary
Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM1PM2PM4PP3
The NM_000363.5(TNNI3):c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC(p.Arg162_Ala171del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000363.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 7 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Hypertrophic cardiomyopathy Uncertain:1
This variant, c.485_514del, results in the deletion of 10 amino acid(s) of the TNNI3 protein (p.Arg162_Ala171del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of TNNI3-related conditions (Invitae). ClinVar contains an entry for this variant (Variation ID: 454407). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant disrupts the p.Arg170, p.Arg162 amino acid residue in TNNI3. Other variant(s) that disrupt this residue have been determined to be pathogenic (PMID: 15607392, 20031618, 22876777, 26440512). This suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at