rs1555863489
Variant summary
Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM1PM2PM4PP3
The NM_000363.5(TNNI3):c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC(p.Arg162_Ala171del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 31)
Consequence
TNNI3
NM_000363.5 disruptive_inframe_deletion
NM_000363.5 disruptive_inframe_deletion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.88
Genes affected
TNNI3 (HGNC:11947): (troponin I3, cardiac type) Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. This gene encodes the TnI-cardiac protein and is exclusively expressed in cardiac muscle tissues. Mutations in this gene cause familial hypertrophic cardiomyopathy type 7 (CMH7) and familial restrictive cardiomyopathy (RCM). Troponin I is useful in making a diagnosis of heart failure, and of ischemic heart disease. An elevated level of troponin is also now used as indicator of acute myocardial injury in patients hospitalized with moderate/severe Coronavirus Disease 2019 (COVID-19). Such elevation has also been associated with higher risk of mortality in cardiovascular disease patients hospitalized due to COVID-19. [provided by RefSeq, Aug 2020]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Likely_pathogenic. Variant got 7 ACMG points.
PM1
In a helix (size 2) in uniprot entity TNNI3_HUMAN there are 6 pathogenic changes around while only 0 benign (100%) in NM_000363.5
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000363.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 31
GnomAD4 genome
Cov.:
31
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Hypertrophic cardiomyopathy Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jan 22, 2024 | This variant, c.485_514del, results in the deletion of 10 amino acid(s) of the TNNI3 protein (p.Arg162_Ala171del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of TNNI3-related conditions (Invitae). ClinVar contains an entry for this variant (Variation ID: 454407). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant disrupts the p.Arg170, p.Arg162 amino acid residue in TNNI3. Other variant(s) that disrupt this residue have been determined to be pathogenic (PMID: 15607392, 20031618, 22876777, 26440512). This suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at