rs1555863489
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3
The NM_000363.5(TNNI3):c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC(p.Arg162_Ala171del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. R162R) has been classified as Likely benign. The gene TNNI3 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000363.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- hypertrophic cardiomyopathyInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- hypertrophic cardiomyopathy 7Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- dilated cardiomyopathy 2AInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- cardiomyopathy, familial restrictive, 1Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- dilated cardiomyopathyInheritance: AD, AR Classification: STRONG Submitted by: ClinGen
- dilated cardiomyopathy 1FFInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- familial isolated restrictive cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- arrhythmogenic right ventricular cardiomyopathyInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000363.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TNNI3 | TSL:1 MANE Select | c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC | p.Arg162_Ala171del | disruptive_inframe_deletion | Exon 7 of 8 | ENSP00000341838.5 | P19429 | ||
| TNNI3 | c.518_547delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC | p.Arg173_Ala182del | disruptive_inframe_deletion | Exon 7 of 8 | ENSP00000499482.1 | A0A590UJN1 | |||
| TNNI3 | c.473_502delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC | p.Arg158_Ala167del | disruptive_inframe_deletion | Exon 7 of 8 | ENSP00000519518.1 | A0AAQ5BHR0 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.