rs1555863489

Variant names:

• chr19-55154064-TGGGCCCGCAGGTCCAGGGACTCCTTAGCCC-T
• rs1555863489
• NM_000363.5:c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP3

The NM_000363.5(TNNI3):​c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC​(p.Arg162_Ala171del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. R162R) has been classified as Likely benign. The gene TNNI3 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 31)
• Consequence: TNNI3 NM_000363.5 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.88
• Publications: 0 publications found

Genes affected

TNNI3 (HGNC:11947): (troponin I3, cardiac type) Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. This gene encodes the TnI-cardiac protein and is exclusively expressed in cardiac muscle tissues. Mutations in this gene cause familial hypertrophic cardiomyopathy type 7 (CMH7) and familial restrictive cardiomyopathy (RCM). Troponin I is useful in making a diagnosis of heart failure, and of ischemic heart disease. An elevated level of troponin is also now used as indicator of acute myocardial injury in patients hospitalized with moderate/severe Coronavirus Disease 2019 (COVID-19). Such elevation has also been associated with higher risk of mortality in cardiovascular disease patients hospitalized due to COVID-19. [provided by RefSeq, Aug 2020]

TNNI3 Gene-Disease associations (from GenCC):

• hypertrophic cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• hypertrophic cardiomyopathy 7

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• dilated cardiomyopathy 2A

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• cardiomyopathy, familial restrictive, 1

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• dilated cardiomyopathy 1FF

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• dilated cardiomyopathy

  Inheritance: AR, AD Classification: STRONG Submitted by: ClinGen
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial isolated restrictive cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Specifications for TNNI3 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 10 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 20 uncertain in NM_000363.5
• PM4: Nonframeshift variant in NON repetitive region in NM_000363.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000363.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TNNI3	NM_000363.5	MANE Select	c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC	p.Arg162_Ala171del	disruptive_inframe_deletion	Exon 7 of 8	NP_000354.4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TNNI3	ENST00000344887.10	TSL:1 MANE Select	c.485_514delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC	p.Arg162_Ala171del	disruptive_inframe_deletion	Exon 7 of 8	ENSP00000341838.5	P19429
	TNNI3	ENST00000665070.1		c.518_547delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC	p.Arg173_Ala182del	disruptive_inframe_deletion	Exon 7 of 8	ENSP00000499482.1	A0A590UJN1
	TNNI3	ENST00000714238.1		c.473_502delGGGCTAAGGAGTCCCTGGACCTGCGGGCCC	p.Arg158_Ala167del	disruptive_inframe_deletion	Exon 7 of 8	ENSP00000519518.1	A0AAQ5BHR0

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Hypertrophic cardiomyopathy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555863489; hg19: chr19-55665432;