chr19-6361578-T-TGGCCCGGAATATTGGTAGGGGG

Position:

• chr19-6361578-T-TGGCCCGGAATATTGGTAGGGGG

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_006012.4(CLPP):​c.12_33dupAATATTGGTAGGGGGGGCCCGG​(p.Val12fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: CLPP NM_006012.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.68

Genes affected

CLPP (HGNC:2084): (caseinolytic mitochondrial matrix peptidase proteolytic subunit) The protein encoded by this gene belongs to the peptidase family S14 and hydrolyzes proteins into small peptides in the presence of ATP and magnesium. The protein is transported into mitochondrial matrix and is associated with the inner mitochondrial membrane. [provided by RefSeq, Jul 2008]

ENSG00000269802 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 10 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 19-6361578-T-TGGCCCGGAATATTGGTAGGGGG is Pathogenic according to our data. Variant chr19-6361578-T-TGGCCCGGAATATTGGTAGGGGG is described in ClinVar as [Pathogenic]. Clinvar id is 1356365.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CLPP	NM_006012.4	c.12_33dupAATATTGGTAGGGGGGGCCCGG	p.Val12fs	frameshift_variant	1/6	ENST00000245816.11	NP_006003.1
CLPP	XM_047439486.1	c.12_33dupAATATTGGTAGGGGGGGCCCGG	p.Val12fs	frameshift_variant	1/5		XP_047295442.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CLPP	ENST00000245816.11	c.12_33dupAATATTGGTAGGGGGGGCCCGG	p.Val12fs	frameshift_variant	1/6	1	NM_006012.4	ENSP00000245816.3
CLPP	ENST00000596070.1	n.22_43dupAATATTGGTAGGGGGGGCCCGG		non_coding_transcript_exon_variant	1/5	5
ENSG00000269802	ENST00000595644.1	n.35+515_35+536dupCCCCCTACCAATATTCCGGGCC		intron_variant		4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Sep 27, 2022

This sequence change creates a premature translational stop signal (p.Val12Asnfs*70) in the CLPP gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CLPP are known to be pathogenic (PMID: 23851121, 27899912). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with CLPP-related conditions. ClinVar contains an entry for this variant (Variation ID: 1356365). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs2091833124; hg19: chr19-6361589;