chr2-178639839-AACTTATTTGGTAGCTTATTTGCCTCTTCTGATATAATTTTGAAATCTTCAAATAACTAGTTTTTAAGAGAATAGTATATTAAGCATTTTGAGACGTTAGAAATCATTTGATACATACTGACTTTCACCTACTATCTTTTATTAAGTACATGTTATGTGTGTGAATACAGAAAGAATATGCTGTTGACATTGAGGATAAGCTTGCTCACCTGCTTCGGGCTTTGGTTTCGGTTCAG-A
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_ModeratePM2PP5_Moderate
The NM_001267550.2(TTN):c.40760_40787-52del(p.Pro13587_Glu13596delinsGln) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P13587P) has been classified as Likely benign.
Frequency
Consequence
NM_001267550.2 splice_donor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
TTN | NM_001267550.2 | c.40760_40787-52del | p.Pro13587_Glu13596delinsGln | splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant | Exon 222 of 363 | ENST00000589042.5 | NP_001254479.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TTN | ENST00000589042.5 | c.40760_40787-52del | p.Pro13587_Glu13596delinsGln | splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant | Exon 222 of 363 | 5 | NM_001267550.2 | ENSP00000467141.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Pathogenic:1
This variant results in the deletion of part of exon 222 (c.40760_40787-52del) of the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TTN-related conditions. ClinVar contains an entry for this variant (Variation ID: 404648). This variant is located in the I band of TTN (PMID: 25589632). Truncating variants in this region have been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875, internal data). Truncating variants in this region have also been identified in individuals affected with autosomal dominant dilated cardiomyopathy and/or cardio-related conditions (PMID: 27869827, 32964742, internal data). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at