rs1553752889

Variant names:

• chr2-178639839-AACTTATTTGGTAGCTTATTTGCCTCTTCTGATATAATTTTGAAATCTTCAAATAACTAGTTTTTAAGAGAATAGTATATTAAGCATTTTGAGACGTTAGAAATCATTTGATACATACTGACTTTCACCTACTATCTTTTATTAAGTACATGTTATGTGTGTGAATACAGAAAGAATATGCTGTTGACATTGAGGATAAGCTTGCTCACCTGCTTCGGGCTTTGGTTTCGGTTCAG-A
• rs1553752889
• NM_001267550.2:c.40760_40787-52del

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Moderate PP5_Moderate

The NM_001267550.2(TTN):​c.40760_40787-52del​(p.Pro13587_Glu13596delinsGln) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P13587P) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TTN NM_001267550.2 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.557
• Publications: 0 publications found

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 8.3351857E-4 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PP5: Variant 2-178639839-AACTTATTTGGTAGCTTATTTGCCTCTTCTGATATAATTTTGAAATCTTCAAATAACTAGTTTTTAAGAGAATAGTATATTAAGCATTTTGAGACGTTAGAAATCATTTGATACATACTGACTTTCACCTACTATCTTTTATTAAGTACATGTTATGTGTGTGAATACAGAAAGAATATGCTGTTGACATTGAGGATAAGCTTGCTCACCTGCTTCGGGCTTTGGTTTCGGTTCAG-A is Pathogenic according to our data. Variant chr2-178639839-AACTTATTTGGTAGCTTATTTGCCTCTTCTGATATAATTTTGAAATCTTCAAATAACTAGTTTTTAAGAGAATAGTATATTAAGCATTTTGAGACGTTAGAAATCATTTGATACATACTGACTTTCACCTACTATCTTTTATTAAGTACATGTTATGTGTGTGAATACAGAAAGAATATGCTGTTGACATTGAGGATAAGCTTGCTCACCTGCTTCGGGCTTTGGTTTCGGTTCAG-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 404648.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001267550.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	NM_001267550.2	MANE Select	c.40760_40787-52del	p.Pro13587_Glu13596delinsGln	splice_donor disruptive_inframe_deletion splice_region intron	Exon 222 of 363	NP_001254479.2
	TTN	NM_001256850.1		c.35837_35864-52del	p.Pro11946_Glu11955delinsGln	splice_donor disruptive_inframe_deletion splice_region intron	Exon 172 of 313	NP_001243779.1
	TTN	NM_133378.4		c.33056_33083-52del	p.Pro11019_Glu11028delinsGln	splice_donor disruptive_inframe_deletion splice_region intron	Exon 171 of 312	NP_596869.4

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TTN	ENST00000589042.5	TSL:5 MANE Select	c.40760_40787-52del	p.Pro13587_Glu13596delinsGln	splice_donor disruptive_inframe_deletion splice_region intron	Exon 222 of 363	ENSP00000467141.1
	TTN	ENST00000446966.2	TSL:1	c.40604_40631-52del	p.Pro13535_Glu13544delinsGln	splice_donor disruptive_inframe_deletion splice_region intron	Exon 220 of 361	ENSP00000408004.2
	TTN	ENST00000436599.2	TSL:1	c.40484_40511-52del	p.Pro13495_Glu13504delinsGln	splice_donor disruptive_inframe_deletion splice_region intron	Exon 220 of 361	ENSP00000405517.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.56

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553752889; hg19: chr2-179504566;