rs1553752889

Positions:

• chr2-178639839-AACTTATTTGGTAGCTTATTTGCCTCTTCTGATATAATTTTGAAATCTTCAAATAACTAGTTTTTAAGAGAATAGTATATTAAGCATTTTGAGACGTTAGAAATCATTTGATACATACTGACTTTCACCTACTATCTTTTATTAAGTACATGTTATGTGTGTGAATACAGAAAGAATATGCTGTTGACATTGAGGATAAGCTTGCTCACCTGCTTCGGGCTTTGGTTTCGGTTCAG-A

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_001267550.2(TTN):​c.40760_40787-52del variant causes a splice donor, splice donor 5th base, coding sequence, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TTN NM_001267550.2 splice_donor, splice_donor_5th_base, coding_sequence, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.557

Genes affected

TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]

TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing variant, NOT destroyed by nmd, known LOF gene, truncates exone, which is 8.2425727E-4 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
TTN	NM_001267550.2	c.40760_40787-52del		splice_donor_variant, splice_donor_5th_base_variant, coding_sequence_variant, intron_variant	222/363	ENST00000589042.5

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
TTN	ENST00000589042.5	c.40760_40787-52del		splice_donor_variant, splice_donor_5th_base_variant, coding_sequence_variant, intron_variant	222/363	5	NM_001267550.2	P1
TTN-AS1	ENST00000659121.1	n.502+42159_502+42393del		intron_variant, non_coding_transcript_variant

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Invitae

Feb 03, 2022

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant is located in the I band of TTN (PMID: 25589632). Truncating variants in this region have been shown to be highly prevalent in the general population and unaffected individuals (PMID: 26701604, 22335739). However, truncating variants in this region have also been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875). ClinVar contains an entry for this variant (Variation ID: 404648). This variant has not been reported in the literature in individuals affected with TTN-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 222 (c.40760_40787-52del) of the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553752889; hg19: chr2-179504566;