chr2-202464772-TAAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGA-T

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5

The NM_001204.7(BMPR2):​c.77-35_86delAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGAA​(p.Ala26fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: not found (cov: 32)

Consequence

BMPR2
NM_001204.7 frameshift, splice_acceptor, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 3.11

Publications

0 publications found
Variant links:
Genes affected
BMPR2 (HGNC:1078): (bone morphogenetic protein receptor type 2) This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of two different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Mutations in this gene have been associated with primary pulmonary hypertension, both familial and fenfluramine-associated, and with pulmonary venoocclusive disease. [provided by RefSeq, May 2020]
BMPR2 Gene-Disease associations (from GenCC):
  • pulmonary arterial hypertension
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • pulmonary hypertension, primary, 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae)
  • heritable pulmonary arterial hypertension
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • congenital heart disease
    Inheritance: AD Classification: LIMITED Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 404 pathogenic variants in the truncated region.
PP5
Variant 2-202464772-TAAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGA-T is Pathogenic according to our data. Variant chr2-202464772-TAAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGA-T is described in ClinVar as Pathogenic. ClinVar VariationId is 425691.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BMPR2NM_001204.7 linkc.77-35_86delAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGAA p.Ala26fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 2 of 13 ENST00000374580.10 NP_001195.2 Q13873-1
BMPR2XM_011511687.2 linkc.77-35_86delAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGAA p.Ala26fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 2 of 13 XP_011509989.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BMPR2ENST00000374580.10 linkc.77-36_85delAAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGA p.Ala26_Asn29delinsAsp splice_acceptor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant Exon 2 of 13 1 NM_001204.7 ENSP00000363708.4 Q13873-1
BMPR2ENST00000374574.2 linkc.77-36_85delAAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGA p.Ala26_Asn29delinsAsp splice_acceptor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant Exon 2 of 12 2 ENSP00000363702.2 Q13873-2
BMPR2ENST00000479069.1 linkn.-53_-9delAAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGA upstream_gene_variant 3

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Pulmonary hypertension, primary, 1 Pathogenic:1
-
Rare Disease Genomics Group, St George's University of London
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
3.1
Mutation Taster
=16/184
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1085307158; hg19: chr2-203329495; API