rs1085307158

Variant names:

• chr2-202464772-TAAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGA-T
• rs1085307158
• NM_001204.7:c.77-35_86delAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGAA

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_001204.7(BMPR2):​c.77-35_86delAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGAA​(p.Ala26fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: BMPR2 NM_001204.7 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 3.11
• Publications: 0 publications found

Genes affected

BMPR2 (HGNC:1078): (bone morphogenetic protein receptor type 2) This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of two different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Mutations in this gene have been associated with primary pulmonary hypertension, both familial and fenfluramine-associated, and with pulmonary venoocclusive disease. [provided by RefSeq, May 2020]

BMPR2 Gene-Disease associations (from GenCC):

• pulmonary arterial hypertension

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• pulmonary hypertension, primary, 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae)
• heritable pulmonary arterial hypertension

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• congenital heart disease

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 404 pathogenic variants in the truncated region.
• PP5: Variant 2-202464772-TAAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGA-T is Pathogenic according to our data. Variant chr2-202464772-TAAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGA-T is described in ClinVar as Pathogenic. ClinVar VariationId is 425691.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001204.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BMPR2	NM_001204.7	MANE Select	c.77-35_86delAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGAA	p.Ala26fs	frameshift splice_acceptor splice_region intron	Exon 2 of 13	NP_001195.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BMPR2	ENST00000374580.10	TSL:1 MANE Select	c.77-36_85delAAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGA	p.Ala26_Asn29delinsAsp	splice_acceptor disruptive_inframe_deletion splice_region intron	Exon 2 of 13	ENSP00000363708.4
	BMPR2	ENST00000374574.2	TSL:2	c.77-36_85delAAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGA	p.Ala26_Asn29delinsAsp	splice_acceptor disruptive_inframe_deletion splice_region intron	Exon 2 of 12	ENSP00000363702.2
	BMPR2	ENST00000479069.1	TSL:3	n.-53_-9delAAATAATTTGTCATTCCTTTATTTCCTTTATTTTAGCTTCGCAGA		upstream_gene	N/A

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Pulmonary hypertension, primary, 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.1
Mutation Taster		=16/184	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1085307158; hg19: chr2-203329495;