chr2-202552727-ACTCAAGGAGACAATCGAAGACTGTT-A

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_001204.7(BMPR2):​c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT​(p.Leu476GlyfsTer22) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

BMPR2
NM_001204.7 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:2

Conservation

PhyloP100: 10.0
Variant links:
Genes affected
BMPR2 (HGNC:1078): (bone morphogenetic protein receptor type 2) This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of two different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Mutations in this gene have been associated with primary pulmonary hypertension, both familial and fenfluramine-associated, and with pulmonary venoocclusive disease. [provided by RefSeq, May 2020]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-202552727-ACTCAAGGAGACAATCGAAGACTGTT-A is Pathogenic according to our data. Variant chr2-202552727-ACTCAAGGAGACAATCGAAGACTGTT-A is described in ClinVar as [Pathogenic]. Clinvar id is 212813.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BMPR2NM_001204.7 linkc.1426_1450delCTCAAGGAGACAATCGAAGACTGTT p.Leu476GlyfsTer22 frameshift_variant Exon 11 of 13 ENST00000374580.10 NP_001195.2 Q13873-1
BMPR2XM_011511687.2 linkc.1426_1450delCTCAAGGAGACAATCGAAGACTGTT p.Leu476GlyfsTer22 frameshift_variant Exon 11 of 13 XP_011509989.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BMPR2ENST00000374580.10 linkc.1426_1450delCTCAAGGAGACAATCGAAGACTGTT p.Leu476GlyfsTer22 frameshift_variant Exon 11 of 13 1 NM_001204.7 ENSP00000363708.4 Q13873-1
BMPR2ENST00000374574.2 linkc.1426_1450delCTCAAGGAGACAATCGAAGACTGTT p.Leu476GlyfsTer22 frameshift_variant Exon 11 of 12 2 ENSP00000363702.2 Q13873-2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Primary pulmonary hypertension Pathogenic:1
Nov 24, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This premature translational stop signal has been observed in individual(s) with pulmonary arterial hypertension (PMID: 26387786). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu476Glyfs*22) in the BMPR2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BMPR2 are known to be pathogenic (PMID: 16429395). ClinVar contains an entry for this variant (Variation ID: 212813). For these reasons, this variant has been classified as Pathogenic. -

Pulmonary hypertension, primary, 1 Pathogenic:1
-
Rare Disease Genomics Group, St George's University of London
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs863223422; hg19: chr2-203417450; API