rs863223422
Positions:
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_001204.7(BMPR2):c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT(p.Leu476fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
BMPR2
NM_001204.7 frameshift
NM_001204.7 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 10.0
Genes affected
BMPR2 (HGNC:1078): (bone morphogenetic protein receptor type 2) This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of two different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Mutations in this gene have been associated with primary pulmonary hypertension, both familial and fenfluramine-associated, and with pulmonary venoocclusive disease. [provided by RefSeq, May 2020]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-202552727-ACTCAAGGAGACAATCGAAGACTGTT-A is Pathogenic according to our data. Variant chr2-202552727-ACTCAAGGAGACAATCGAAGACTGTT-A is described in ClinVar as [Pathogenic]. Clinvar id is 212813.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
BMPR2 | NM_001204.7 | c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT | p.Leu476fs | frameshift_variant | 11/13 | ENST00000374580.10 | NP_001195.2 | |
BMPR2 | XM_011511687.2 | c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT | p.Leu476fs | frameshift_variant | 11/13 | XP_011509989.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
BMPR2 | ENST00000374580.10 | c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT | p.Leu476fs | frameshift_variant | 11/13 | 1 | NM_001204.7 | ENSP00000363708.4 | ||
BMPR2 | ENST00000374574.2 | c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT | p.Leu476fs | frameshift_variant | 11/12 | 2 | ENSP00000363702.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Primary pulmonary hypertension Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Nov 24, 2022 | This variant is not present in population databases (gnomAD no frequency). For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 212813). This premature translational stop signal has been observed in individual(s) with pulmonary arterial hypertension (PMID: 26387786). This sequence change creates a premature translational stop signal (p.Leu476Glyfs*22) in the BMPR2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BMPR2 are known to be pathogenic (PMID: 16429395). - |
Pulmonary hypertension, primary, 1 Pathogenic:1
Pathogenic, no assertion criteria provided | literature only | Rare Disease Genomics Group, St George's University of London | - | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at