rs863223422
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001204.7(BMPR2):c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT(p.Leu476GlyfsTer22) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. L476L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001204.7 frameshift
Scores
Clinical Significance
Conservation
Publications
- pulmonary arterial hypertensionInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- pulmonary hypertension, primary, 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae)
- heritable pulmonary arterial hypertensionInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- congenital heart diseaseInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| BMPR2 | NM_001204.7 | c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT | p.Leu476GlyfsTer22 | frameshift_variant | Exon 11 of 13 | ENST00000374580.10 | NP_001195.2 | |
| BMPR2 | XM_011511687.2 | c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT | p.Leu476GlyfsTer22 | frameshift_variant | Exon 11 of 13 | XP_011509989.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| BMPR2 | ENST00000374580.10 | c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT | p.Leu476GlyfsTer22 | frameshift_variant | Exon 11 of 13 | 1 | NM_001204.7 | ENSP00000363708.4 | ||
| BMPR2 | ENST00000374574.2 | c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT | p.Leu476GlyfsTer22 | frameshift_variant | Exon 11 of 12 | 2 | ENSP00000363702.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Primary pulmonary hypertension Pathogenic:1
This premature translational stop signal has been observed in individual(s) with pulmonary arterial hypertension (PMID: 26387786). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu476Glyfs*22) in the BMPR2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BMPR2 are known to be pathogenic (PMID: 16429395). ClinVar contains an entry for this variant (Variation ID: 212813). For these reasons, this variant has been classified as Pathogenic. -
Pulmonary hypertension, primary, 1 Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at