rs863223422

Variant names:

• chr2-202552727-ACTCAAGGAGACAATCGAAGACTGTT-A
• rs863223422
• NM_001204.7:c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_001204.7(BMPR2):​c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT​(p.Leu476GlyfsTer22) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: BMPR2 NM_001204.7 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 10.0

Genes affected

BMPR2 (HGNC:1078): (bone morphogenetic protein receptor type 2) This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of two different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Mutations in this gene have been associated with primary pulmonary hypertension, both familial and fenfluramine-associated, and with pulmonary venoocclusive disease. [provided by RefSeq, May 2020]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-202552727-ACTCAAGGAGACAATCGAAGACTGTT-A is Pathogenic according to our data. Variant chr2-202552727-ACTCAAGGAGACAATCGAAGACTGTT-A is described in ClinVar as [Pathogenic]. Clinvar id is 212813.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BMPR2	NM_001204.7	c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT	p.Leu476GlyfsTer22	frameshift_variant	Exon 11 of 13	ENST00000374580.10	NP_001195.2
BMPR2	XM_011511687.2	c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT	p.Leu476GlyfsTer22	frameshift_variant	Exon 11 of 13		XP_011509989.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BMPR2	ENST00000374580.10	c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT	p.Leu476GlyfsTer22	frameshift_variant	Exon 11 of 13	1	NM_001204.7	ENSP00000363708.4
BMPR2	ENST00000374574.2	c.1426_1450delCTCAAGGAGACAATCGAAGACTGTT	p.Leu476GlyfsTer22	frameshift_variant	Exon 11 of 12	2		ENSP00000363702.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Primary pulmonary hypertension Pathogenic:1

Nov 24, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This premature translational stop signal has been observed in individual(s) with pulmonary arterial hypertension (PMID: 26387786). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu476Glyfs*22) in the BMPR2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BMPR2 are known to be pathogenic (PMID: 16429395). ClinVar contains an entry for this variant (Variation ID: 212813). For these reasons, this variant has been classified as Pathogenic. -

Pulmonary hypertension, primary, 1 Pathogenic:1

-

Rare Disease Genomics Group, St George's University of London

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs863223422; hg19: chr2-203417450;