chr2-232544409-CGCCCGCTGGCCCCGGCAGCTGT-C
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_005199.5(CHRNG):c.1081_1102delCCGCTGGCCCCGGCAGCTGTGC(p.Pro361ArgfsTer49) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000118 in 1,613,446 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P361P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_005199.5 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005199.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CHRNG | MANE Select | c.1081_1102delCCGCTGGCCCCGGCAGCTGTGC | p.Pro361ArgfsTer49 | frameshift | Exon 10 of 12 | ENSP00000498757.1 | P07510-1 | ||
| CHRNG | TSL:1 | c.925_946delCCGCTGGCCCCGGCAGCTGTGC | p.Pro309ArgfsTer49 | frameshift | Exon 9 of 11 | ENSP00000374143.3 | P07510-2 | ||
| TIGD1 | TSL:6 MANE Select | c.*3676_*3697delACAGCTGCCGGGGCCAGCGGGC | 3_prime_UTR | Exon 1 of 1 | ENSP00000386186.3 | Q96MW7 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152216Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000121 AC: 3AN: 248712 AF XY: 0.0000148 show subpopulations
GnomAD4 exome AF: 0.0000123 AC: 18AN: 1461230Hom.: 0 AF XY: 0.0000124 AC XY: 9AN XY: 726932 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152216Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1AN XY: 74354 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at