chr2-233760894-CACATGACCTTCCTGCAGCGGGTGA-C

Variant summary

Our verdict is Pathogenic. Variant got 13 ACMG points: 13P and 0B. PM2PM4PP3PP5_Very_Strong

The NM_000463.3(UGT1A1):​c.609_632delCATGACCTTCCTGCAGCGGGTGAA​(p.His203_Lys211delinsGln) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000342 in 1,461,894 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

Frequency

Genomes: not found (cov: 33)
Exomes 𝑓: 0.0000034 ( 0 hom. )

Consequence

UGT1A1
NM_000463.3 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 9.95
Variant links:
Genes affected
UGT1A1 (HGNC:12530): (UDP glucuronosyltransferase family 1 member A1) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The preferred substrate of this enzyme is bilirubin, although it also has moderate activity with simple phenols, flavones, and C18 steroids. Mutations in this gene result in Crigler-Najjar syndromes types I and II and in Gilbert syndrome. [provided by RefSeq, Jul 2008]
UGT1A4 (HGNC:12536): (UDP glucuronosyltransferase family 1 member A4) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. This enzyme has some glucuronidase activity towards bilirubin, although is is more active on amines, steroids, and sapogenins. [provided by RefSeq, Jul 2008]
UGT1A5 (HGNC:12537): (UDP glucuronosyltransferase family 1 member A5) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. [provided by RefSeq, Jul 2008]
UGT1A3 (HGNC:12535): (UDP glucuronosyltransferase family 1 member A3) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. Substrates of this enzyme include estrone, 2-hydroxyestrone, and metabolites of benzo alpha-pyrene. [provided by RefSeq, Jul 2008]
UGT1A6 (HGNC:12538): (UDP glucuronosyltransferase family 1 member A6) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene is active on phenolic and planar compounds. Alternative splicing in the unique 5' end of this gene results in two transcript variants. [provided by RefSeq, Jul 2008]
UGT1A10 (HGNC:12531): (UDP glucuronosyltransferase family 1 member A10) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has glucuronidase activity on mycophenolic acid, coumarins, and quinolines. [provided by RefSeq, Jul 2008]
UGT1A8 (HGNC:12540): (UDP glucuronosyltransferase family 1 member A8) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has glucuronidase activity with many substrates including coumarins, phenols, anthraquinones, flavones, and some opioids. [provided by RefSeq, Jul 2008]
UGT1A7 (HGNC:12539): (UDP glucuronosyltransferase family 1 member A7) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has moderate glucuronidase activity with phenols. [provided by RefSeq, Jul 2008]
UGT1A9 (HGNC:12541): (UDP glucuronosyltransferase family 1 member A9) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene is active on phenols. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 13 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000463.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 2-233760894-CACATGACCTTCCTGCAGCGGGTGA-C is Pathogenic according to our data. Variant chr2-233760894-CACATGACCTTCCTGCAGCGGGTGA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 437208.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr2-233760894-CACATGACCTTCCTGCAGCGGGTGA-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
UGT1A1NM_000463.3 linkc.609_632delCATGACCTTCCTGCAGCGGGTGAA p.His203_Lys211delinsGln disruptive_inframe_deletion Exon 1 of 5 ENST00000305208.10 NP_000454.1 P22309-1Q5DT03
UGT1A4NM_007120.3 linkc.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 ENST00000373409.8 NP_009051.1 P22310-1
UGT1A5NM_019078.2 linkc.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 ENST00000373414.4 NP_061951.1 P35504-1Q5DSZ9
UGT1A3NM_019093.4 linkc.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 ENST00000482026.6 NP_061966.1 P35503-1Q5DT01
UGT1A6NM_001072.4 linkc.862-6138_862-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 ENST00000305139.11 NP_001063.2 P19224-1Q5DSZ8
UGT1A10NM_019075.4 linkc.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 ENST00000344644.10 NP_061948.1 Q9HAW8-1Q5DT02
UGT1A8NM_019076.5 linkc.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 ENST00000373450.5 NP_061949.3 Q9HAW9-1Q5DSZ6
UGT1A7NM_019077.3 linkc.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 ENST00000373426.4 NP_061950.2 Q9HAW7-1Q5DSZ7
UGT1A9NM_021027.3 linkc.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 ENST00000354728.5 NP_066307.1 O60656-1Q5DSZ5

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
UGT1A1ENST00000305208.10 linkc.609_632delCATGACCTTCCTGCAGCGGGTGAA p.His203_Lys211delinsGln disruptive_inframe_deletion Exon 1 of 5 1 NM_000463.3 ENSP00000304845.5 P22309-1
UGT1A4ENST00000373409.8 linkc.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 1 NM_007120.3 ENSP00000362508.4 P22310-1
UGT1A5ENST00000373414.4 linkc.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 1 NM_019078.2 ENSP00000362513.3 P35504-1
UGT1A3ENST00000482026.6 linkc.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 1 NM_019093.4 ENSP00000418532.1 P35503-1
UGT1A6ENST00000305139.11 linkc.862-6138_862-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 1 NM_001072.4 ENSP00000303174.6 P19224-1
UGT1A10ENST00000344644.10 linkc.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 1 NM_019075.4 ENSP00000343838.5 Q9HAW8-1
UGT1A9ENST00000354728.5 linkc.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 1 NM_021027.3 ENSP00000346768.4 O60656-1
UGT1A7ENST00000373426.4 linkc.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 1 NM_019077.3 ENSP00000362525.3 Q9HAW7-1
UGT1A8ENST00000373450.5 linkc.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA intron_variant Intron 1 of 4 1 NM_019076.5 ENSP00000362549.4 Q9HAW9-1

Frequencies

GnomAD3 genomes
Cov.:
33
GnomAD4 exome
AF:
0.00000342
AC:
5
AN:
1461894
Hom.:
0
AF XY:
0.00000275
AC XY:
2
AN XY:
727248
show subpopulations
Gnomad4 AFR exome
AF:
0.00
Gnomad4 AMR exome
AF:
0.0000224
Gnomad4 ASJ exome
AF:
0.00
Gnomad4 EAS exome
AF:
0.00
Gnomad4 SAS exome
AF:
0.00
Gnomad4 FIN exome
AF:
0.00
Gnomad4 NFE exome
AF:
0.00000180
Gnomad4 OTH exome
AF:
0.0000331
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Crigler-Najjar syndrome Pathogenic:1
May 26, 2016
Genetic Services Laboratory, University of Chicago
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

not provided Pathogenic:1
Nov 02, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant, c.609_632del, is a complex sequence change that results in the deletion of 9 amino acids and insertion of 1 amino acid(s) in the UGT1A1 protein (p.His203_Lys211delinsGln). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with UGT1A1-related hyperbilirubinemia (PMID: 19217809; internal data). ClinVar contains an entry for this variant (Variation ID: 437208). This variant disrupts a region of the UGT1A1 protein in which other variant(s) (p.Arg209Trp) have been determined to be pathogenic (PMID: 8514037, 25993113). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1553620849; hg19: chr2-234669540; API