rs1553620849

Variant names:

• chr2-233760894-CACATGACCTTCCTGCAGCGGGTGA-C
• rs1553620849
• NM_000463.3:c.609_632delCATGACCTTCCTGCAGCGGGTGAA

Variant summary

Our verdict is Pathogenic. Variant got 13 ACMG points: 13P and 0B. PM2 PM4 PP3 PP5_Very_Strong

The NM_000463.3(UGT1A1):​c.609_632delCATGACCTTCCTGCAGCGGGTGAA​(p.His203_Lys211delinsGln) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000342 in 1,461,894 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000034 (0 hom.)
• Consequence: UGT1A1 NM_000463.3 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 9.95

Genes affected

UGT1A1 (HGNC:12530): (UDP glucuronosyltransferase family 1 member A1) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The preferred substrate of this enzyme is bilirubin, although it also has moderate activity with simple phenols, flavones, and C18 steroids. Mutations in this gene result in Crigler-Najjar syndromes types I and II and in Gilbert syndrome. [provided by RefSeq, Jul 2008]

UGT1A4 (HGNC:12536): (UDP glucuronosyltransferase family 1 member A4) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. This enzyme has some glucuronidase activity towards bilirubin, although is is more active on amines, steroids, and sapogenins. [provided by RefSeq, Jul 2008]

UGT1A5 (HGNC:12537): (UDP glucuronosyltransferase family 1 member A5) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. [provided by RefSeq, Jul 2008]

UGT1A3 (HGNC:12535): (UDP glucuronosyltransferase family 1 member A3) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. Substrates of this enzyme include estrone, 2-hydroxyestrone, and metabolites of benzo alpha-pyrene. [provided by RefSeq, Jul 2008]

UGT1A6 (HGNC:12538): (UDP glucuronosyltransferase family 1 member A6) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene is active on phenolic and planar compounds. Alternative splicing in the unique 5' end of this gene results in two transcript variants. [provided by RefSeq, Jul 2008]

UGT1A10 (HGNC:12531): (UDP glucuronosyltransferase family 1 member A10) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has glucuronidase activity on mycophenolic acid, coumarins, and quinolines. [provided by RefSeq, Jul 2008]

UGT1A8 (HGNC:12540): (UDP glucuronosyltransferase family 1 member A8) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has glucuronidase activity with many substrates including coumarins, phenols, anthraquinones, flavones, and some opioids. [provided by RefSeq, Jul 2008]

UGT1A7 (HGNC:12539): (UDP glucuronosyltransferase family 1 member A7) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has moderate glucuronidase activity with phenols. [provided by RefSeq, Jul 2008]

UGT1A9 (HGNC:12541): (UDP glucuronosyltransferase family 1 member A9) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene is active on phenols. [provided by RefSeq, Jul 2008]

UGT1A (HGNC:12529):

ACMG classification

Verdict is Pathogenic. Variant got 13 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000463.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 2-233760894-CACATGACCTTCCTGCAGCGGGTGA-C is Pathogenic according to our data. Variant chr2-233760894-CACATGACCTTCCTGCAGCGGGTGA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 437208.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr2-233760894-CACATGACCTTCCTGCAGCGGGTGA-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
UGT1A1	NM_000463.3	c.609_632delCATGACCTTCCTGCAGCGGGTGAA	p.His203_Lys211delinsGln	disruptive_inframe_deletion	Exon 1 of 5	ENST00000305208.10	NP_000454.1
UGT1A4	NM_007120.3	c.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	ENST00000373409.8	NP_009051.1
UGT1A5	NM_019078.2	c.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	ENST00000373414.4	NP_061951.1
UGT1A3	NM_019093.4	c.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	ENST00000482026.6	NP_061966.1
UGT1A6	NM_001072.4	c.862-6138_862-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	ENST00000305139.11	NP_001063.2
UGT1A10	NM_019075.4	c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	ENST00000344644.10	NP_061948.1
UGT1A8	NM_019076.5	c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	ENST00000373450.5	NP_061949.3
UGT1A7	NM_019077.3	c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	ENST00000373426.4	NP_061950.2
UGT1A9	NM_021027.3	c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	ENST00000354728.5	NP_066307.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
UGT1A1	ENST00000305208.10	c.609_632delCATGACCTTCCTGCAGCGGGTGAA	p.His203_Lys211delinsGln	disruptive_inframe_deletion	Exon 1 of 5	1	NM_000463.3	ENSP00000304845.5
UGT1A4	ENST00000373409.8	c.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	1	NM_007120.3	ENSP00000362508.4
UGT1A5	ENST00000373414.4	c.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	1	NM_019078.2	ENSP00000362513.3
UGT1A3	ENST00000482026.6	c.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	1	NM_019093.4	ENSP00000418532.1
UGT1A6	ENST00000305139.11	c.862-6138_862-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	1	NM_001072.4	ENSP00000303174.6
UGT1A10	ENST00000344644.10	c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	1	NM_019075.4	ENSP00000343838.5
UGT1A9	ENST00000354728.5	c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	1	NM_021027.3	ENSP00000346768.4
UGT1A7	ENST00000373426.4	c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	1	NM_019077.3	ENSP00000362525.3
UGT1A8	ENST00000373450.5	c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA		intron_variant	Intron 1 of 4	1	NM_019076.5	ENSP00000362549.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000342 AC: 5 AN: 1461894 Hom.: 0 AF XY: 0.00000275 AC XY: 2 AN XY: 727248

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000224

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000180

Gnomad4 OTH exome AF: 0.0000331

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Crigler-Najjar syndrome Pathogenic:1

May 26, 2016

Genetic Services Laboratory, University of Chicago

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:1

Nov 02, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.609_632del, is a complex sequence change that results in the deletion of 9 amino acids and insertion of 1 amino acid(s) in the UGT1A1 protein (p.His203_Lys211delinsGln). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with UGT1A1-related hyperbilirubinemia (PMID: 19217809; internal data). ClinVar contains an entry for this variant (Variation ID: 437208). This variant disrupts a region of the UGT1A1 protein in which other variant(s) (p.Arg209Trp) have been determined to be pathogenic (PMID: 8514037, 25993113). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553620849; hg19: chr2-234669540;