rs1553620849
Positions:
Variant summary
Our verdict is Pathogenic. Variant got 13 ACMG points: 13P and 0B. PM2PM4PP3PP5_Very_Strong
The NM_000463.3(UGT1A1):c.609_632delCATGACCTTCCTGCAGCGGGTGAA(p.His203_Lys211delinsGln) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000342 in 1,461,894 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Genomes: not found (cov: 33)
Exomes 𝑓: 0.0000034 ( 0 hom. )
Consequence
UGT1A1
NM_000463.3 disruptive_inframe_deletion
NM_000463.3 disruptive_inframe_deletion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.95
Genes affected
UGT1A1 (HGNC:12530): (UDP glucuronosyltransferase family 1 member A1) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The preferred substrate of this enzyme is bilirubin, although it also has moderate activity with simple phenols, flavones, and C18 steroids. Mutations in this gene result in Crigler-Najjar syndromes types I and II and in Gilbert syndrome. [provided by RefSeq, Jul 2008]
UGT1A4 (HGNC:12536): (UDP glucuronosyltransferase family 1 member A4) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. This enzyme has some glucuronidase activity towards bilirubin, although is is more active on amines, steroids, and sapogenins. [provided by RefSeq, Jul 2008]
UGT1A5 (HGNC:12537): (UDP glucuronosyltransferase family 1 member A5) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. [provided by RefSeq, Jul 2008]
UGT1A3 (HGNC:12535): (UDP glucuronosyltransferase family 1 member A3) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. Substrates of this enzyme include estrone, 2-hydroxyestrone, and metabolites of benzo alpha-pyrene. [provided by RefSeq, Jul 2008]
UGT1A6 (HGNC:12538): (UDP glucuronosyltransferase family 1 member A6) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene is active on phenolic and planar compounds. Alternative splicing in the unique 5' end of this gene results in two transcript variants. [provided by RefSeq, Jul 2008]
UGT1A10 (HGNC:12531): (UDP glucuronosyltransferase family 1 member A10) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has glucuronidase activity on mycophenolic acid, coumarins, and quinolines. [provided by RefSeq, Jul 2008]
UGT1A8 (HGNC:12540): (UDP glucuronosyltransferase family 1 member A8) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has glucuronidase activity with many substrates including coumarins, phenols, anthraquinones, flavones, and some opioids. [provided by RefSeq, Jul 2008]
UGT1A7 (HGNC:12539): (UDP glucuronosyltransferase family 1 member A7) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene has moderate glucuronidase activity with phenols. [provided by RefSeq, Jul 2008]
UGT1A9 (HGNC:12541): (UDP glucuronosyltransferase family 1 member A9) This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The enzyme encoded by this gene is active on phenols. [provided by RefSeq, Jul 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 13 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000463.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 2-233760894-CACATGACCTTCCTGCAGCGGGTGA-C is Pathogenic according to our data. Variant chr2-233760894-CACATGACCTTCCTGCAGCGGGTGA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 437208.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr2-233760894-CACATGACCTTCCTGCAGCGGGTGA-C is described in Lovd as [Pathogenic].
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
UGT1A1 | NM_000463.3 | c.609_632delCATGACCTTCCTGCAGCGGGTGAA | p.His203_Lys211delinsGln | disruptive_inframe_deletion | 1/5 | ENST00000305208.10 | NP_000454.1 | |
UGT1A4 | NM_007120.3 | c.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | ENST00000373409.8 | NP_009051.1 | |||
UGT1A5 | NM_019078.2 | c.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | ENST00000373414.4 | NP_061951.1 | |||
UGT1A3 | NM_019093.4 | c.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | ENST00000482026.6 | NP_061966.1 | |||
UGT1A6 | NM_001072.4 | c.862-6138_862-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | ENST00000305139.11 | NP_001063.2 | |||
UGT1A10 | NM_019075.4 | c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | ENST00000344644.10 | NP_061948.1 | |||
UGT1A8 | NM_019076.5 | c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | ENST00000373450.5 | NP_061949.3 | |||
UGT1A7 | NM_019077.3 | c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | ENST00000373426.4 | NP_061950.2 | |||
UGT1A9 | NM_021027.3 | c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | ENST00000354728.5 | NP_066307.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
UGT1A1 | ENST00000305208.10 | c.609_632delCATGACCTTCCTGCAGCGGGTGAA | p.His203_Lys211delinsGln | disruptive_inframe_deletion | 1/5 | 1 | NM_000463.3 | ENSP00000304845.5 | ||
UGT1A4 | ENST00000373409.8 | c.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | 1 | NM_007120.3 | ENSP00000362508.4 | ||||
UGT1A5 | ENST00000373414.4 | c.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | 1 | NM_019078.2 | ENSP00000362513.3 | ||||
UGT1A3 | ENST00000482026.6 | c.868-6138_868-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | 1 | NM_019093.4 | ENSP00000418532.1 | ||||
UGT1A6 | ENST00000305139.11 | c.862-6138_862-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | 1 | NM_001072.4 | ENSP00000303174.6 | ||||
UGT1A10 | ENST00000344644.10 | c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | 1 | NM_019075.4 | ENSP00000343838.5 | ||||
UGT1A9 | ENST00000354728.5 | c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | 1 | NM_021027.3 | ENSP00000346768.4 | ||||
UGT1A7 | ENST00000373426.4 | c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | 1 | NM_019077.3 | ENSP00000362525.3 | ||||
UGT1A8 | ENST00000373450.5 | c.856-6138_856-6115delCATGACCTTCCTGCAGCGGGTGAA | intron_variant | 1 | NM_019076.5 | ENSP00000362549.4 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
GnomAD4 exome AF: 0.00000342 AC: 5AN: 1461894Hom.: 0 AF XY: 0.00000275 AC XY: 2AN XY: 727248
GnomAD4 exome
AF:
AC:
5
AN:
1461894
Hom.:
AF XY:
AC XY:
2
AN XY:
727248
Gnomad4 AFR exome
AF:
Gnomad4 AMR exome
AF:
Gnomad4 ASJ exome
AF:
Gnomad4 EAS exome
AF:
Gnomad4 SAS exome
AF:
Gnomad4 FIN exome
AF:
Gnomad4 NFE exome
AF:
Gnomad4 OTH exome
AF:
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Crigler-Najjar syndrome Pathogenic:1
Likely pathogenic, criteria provided, single submitter | clinical testing | Genetic Services Laboratory, University of Chicago | May 26, 2016 | - - |
not provided Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Nov 02, 2024 | This variant, c.609_632del, is a complex sequence change that results in the deletion of 9 amino acids and insertion of 1 amino acid(s) in the UGT1A1 protein (p.His203_Lys211delinsGln). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with UGT1A1-related hyperbilirubinemia (PMID: 19217809; internal data). ClinVar contains an entry for this variant (Variation ID: 437208). This variant disrupts a region of the UGT1A1 protein in which other variant(s) (p.Arg209Trp) have been determined to be pathogenic (PMID: 8514037, 25993113). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at