chr2-26479600-GGGGCCGAGGCCGCTGGGGCC-G
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_194248.3(OTOF):c.1946_1965delGGCCCCAGCGGCCTCGGCCC(p.Arg649ProfsTer7) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_194248.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- autosomal recessive nonsyndromic hearing loss 9Inheritance: AR, Unknown Classification: DEFINITIVE, STRONG Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae)
- hearing loss, autosomal recessiveInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_194248.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| OTOF | MANE Select | c.1946_1965delGGCCCCAGCGGCCTCGGCCC | p.Arg649ProfsTer7 | frameshift | Exon 17 of 47 | NP_919224.1 | Q9HC10-1 | ||
| OTOF | c.1946_1965delGGCCCCAGCGGCCTCGGCCC | p.Arg649ProfsTer7 | frameshift | Exon 17 of 46 | NP_001274418.1 | Q9HC10-5 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| OTOF | TSL:1 MANE Select | c.1946_1965delGGCCCCAGCGGCCTCGGCCC | p.Arg649ProfsTer7 | frameshift | Exon 17 of 47 | ENSP00000272371.2 | Q9HC10-1 | ||
| OTOF | TSL:5 | c.1946_1965delGGCCCCAGCGGCCTCGGCCC | p.Arg649ProfsTer7 | frameshift | Exon 17 of 46 | ENSP00000385255.3 | Q9HC10-5 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at