rs1553353527

Variant names:

• chr2-26479600-GGGGCCGAGGCCGCTGGGGCC-G
• rs1553353527
• NM_194248.3:c.1946_1965delGGCCCCAGCGGCCTCGGCCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_194248.3(OTOF):​c.1946_1965delGGCCCCAGCGGCCTCGGCCC​(p.Arg649ProfsTer7) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: OTOF NM_194248.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.24
• Publications: 0 publications found

Genes affected

OTOF (HGNC:8515): (otoferlin) Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

OTOF Gene-Disease associations (from GenCC):

• autosomal recessive nonsyndromic hearing loss 9

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), G2P
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-26479600-GGGGCCGAGGCCGCTGGGGCC-G is Pathogenic according to our data. Variant chr2-26479600-GGGGCCGAGGCCGCTGGGGCC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 446439.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
OTOF	NM_194248.3	c.1946_1965delGGCCCCAGCGGCCTCGGCCC	p.Arg649ProfsTer7	frameshift_variant	Exon 17 of 47	ENST00000272371.7	NP_919224.1
OTOF	NM_001287489.2	c.1946_1965delGGCCCCAGCGGCCTCGGCCC	p.Arg649ProfsTer7	frameshift_variant	Exon 17 of 46		NP_001274418.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
OTOF	ENST00000272371.7	c.1946_1965delGGCCCCAGCGGCCTCGGCCC	p.Arg649ProfsTer7	frameshift_variant	Exon 17 of 47	1	NM_194248.3	ENSP00000272371.2
OTOF	ENST00000403946.7	c.1946_1965delGGCCCCAGCGGCCTCGGCCC	p.Arg649ProfsTer7	frameshift_variant	Exon 17 of 46	5		ENSP00000385255.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Autosomal recessive nonsyndromic hearing loss 9 Pathogenic:1

Jul 01, 2017

Division of Hearing and Balance Research, National Hospital Organization Tokyo Medical Center

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.2
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553353527; hg19: chr2-26702468;