chr2-27309851-TCTGACCGTTCCAGGGTCAAGCTGCATCACTGCAAGGTGGAAACGATGGAGTGAGGCAGGCTTAGAGCCGATGTGCCTTCCAGGACAGGTAGGAGTTCCAGATAACAGCAACACATTGGACAACGGCCAACCTAAGGAACAGGAATAAC-T
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_ModeratePP5_Moderate
The NM_002437.5(MPV17):c.462-18_*60del variant causes a splice acceptor, splice region, 3 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_002437.5 splice_acceptor, splice_region, 3_prime_UTR, intron
Scores
Clinical Significance
Conservation
Publications
- mitochondrial diseaseInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- mitochondrial DNA depletion syndrome 6 (hepatocerebral type)Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics, Orphanet
- Charcot-Marie-Tooth disease, axonal, type 2EEInheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002437.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MPV17 | NM_002437.5 | MANE Select | c.462-18_*60del | p.Arg154fs | frameshift stop_lost splice_region | Exon 8 of 8 | NP_002428.1 | P39210 | |
| MPV17 | NM_002437.5 | MANE Select | c.462-18_*60del | splice_acceptor splice_region 3_prime_UTR intron | Exon 8 of 8 | NP_002428.1 | P39210 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MPV17 | ENST00000380044.6 | TSL:1 MANE Select | c.462-18_*60del | p.Arg154fs | frameshift stop_lost splice_region | Exon 8 of 8 | ENSP00000369383.1 | P39210 | |
| MPV17 | ENST00000233545.6 | TSL:1 | c.462-18_*60del | p.Arg154fs | frameshift stop_lost splice_region | Exon 7 of 7 | ENSP00000233545.2 | P39210 | |
| MPV17 | ENST00000380044.6 | TSL:1 MANE Select | c.462-18_*60del | splice_acceptor splice_region 3_prime_UTR intron | Exon 8 of 8 | ENSP00000369383.1 | P39210 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at