chr2-47369542-C-CTTGCCGCGGCGACGGCGACTT

Variant names:

• chr2-47369542-C-CTTGCCGCGGCGACGGCGACTT
• NM_002354.3:c.45_65dupGGCGACGGCGACTTTTGCCGC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_002354.3(EPCAM):​c.45_65dupGGCGACGGCGACTTTTGCCGC​(p.Ala22_Ala23insAlaThrAlaThrPheAlaAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000698 in 1,432,394 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 7.0e-7 (0 hom.)
• Consequence: EPCAM NM_002354.3 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.68

Genes affected

EPCAM (HGNC:11529): (epithelial cell adhesion molecule) This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_002354.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EPCAM	NM_002354.3	c.45_65dupGGCGACGGCGACTTTTGCCGC	p.Ala22_Ala23insAlaThrAlaThrPheAlaAla	disruptive_inframe_insertion	Exon 1 of 9	ENST00000263735.9	NP_002345.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EPCAM	ENST00000263735.9	c.45_65dupGGCGACGGCGACTTTTGCCGC	p.Ala22_Ala23insAlaThrAlaThrPheAlaAla	disruptive_inframe_insertion	Exon 1 of 9	1	NM_002354.3	ENSP00000263735.4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 6.98e-7 AC: 1 AN: 1432394 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 710430

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.08e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-47596681;