chr2-47475082-TCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA-T

Variant names:

• chr2-47475082-TCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA-T
• rs1553368576
• NM_000251.3:c.1818_1877delCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_000251.3(MSH2):​c.1818_1877delCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA​(p.Ser607_Glu626del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. V606V) has been classified as Benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MSH2 NM_000251.3 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:2
• Conservation: PhyloP100: 9.13
• Publications: 1 publications found

Genes affected

MSH2 (HGNC:7325): (mutS homolog 2) This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

MSH2 Gene-Disease associations (from GenCC):

• Lynch syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
• Lynch syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• Muir-Torre syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
• mismatch repair cancer syndrome 1

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• mismatch repair cancer syndrome 2

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• ovarian cancer

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• malignant pancreatic neoplasm

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• prostate cancer

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• rhabdomyosarcoma

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• breast cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 14 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 28 benign, 27 uncertain in NM_000251.3
• PM4: Nonframeshift variant in NON repetitive region in NM_000251.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 2-47475082-TCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA-T is Pathogenic according to our data. Variant chr2-47475082-TCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA-T is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 408533.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MSH2	NM_000251.3	c.1818_1877delCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA	p.Ser607_Glu626del	disruptive_inframe_deletion	Exon 12 of 16	ENST00000233146.7	NP_000242.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MSH2	ENST00000233146.7	c.1818_1877delCAGCTTTGCTCACGTGTCAAATGGAGCACCTGTTCCATATGTACGACCAGCCATTTTGGA	p.Ser607_Glu626del	disruptive_inframe_deletion	Exon 12 of 16	1	NM_000251.3	ENSP00000233146.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:2

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1 Uncertain:1

Apr 07, 2021

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1818_1877del60 pathogenic mutation (also known as p.S607_E626del) is located in coding exon 12 of the MSH2 gene. This pathogenic mutation results from an in-frame 60 nucleotide deletion at positions 1818 to 1877. This results in the in-frame deletion of 20 amino acids at codons 607 to 626. This alteration is observed in an individual diagnosed with colorectal cancer and sebaceous epithelioma, which demonstrated loss of MSH2 and MSH6 expression on immunohistochemistry (IHC), and has a family history of Lynch-related tumors (Ambry internal data). Based on internal structural analysis using published crystal structures, S607_E626del removes a portion of MSH2 linking the MutS III and V domains, a region enriched in pathogenic variants (Warren JJ et al. Mol Cell, 2007 May;26:579-92; Ambry internal data). This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). This amino acid region is generally well conserved through mammals. Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. -

Feb 02, 2021

Color Diagnostics, LLC DBA Color Health

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in a deletion of 60 nucleotides in exon 12, resulting in an in-frame deletion of 20 amino acids from the MSH2 protein. To our knowledge, functional studies have not been reported for this variant. This deletion overlaps a region encoding a domain involved in interaction with the EXO1 and MSH6 proteins but the functional impact of this deletion is not known. This variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -

Hereditary nonpolyposis colorectal neoplasms Uncertain:1

Nov 23, 2016

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, this is a novel in-frame deletion with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant. However, this deletion affects a region encoding the EXO1 and MSH6 interaction domains known to be important for the mismatch repair function of the MSH2 protein (PMID: 18822302, 9774676) This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a MSH2-related disease. This sequence change deletes 60 nucleotides from exon 12 of the MSH2 mRNA (c.1818_1877del). This leads to the deletion of 20 amino acid residues in the MSH2 protein (p.Ser607_Glu626del) but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553368576; hg19: chr2-47702221;